CAPZB cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11627-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CAPZB Reagents
CRO Services
Product recommended

All CAPZB Reagents
CAPZB cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
819 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human capping protein (actin filament) muscle Z-line, beta with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.86kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CAPZB cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CAPZB cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human CASP2 Gene Expression validated Image 16785
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
CAPZB cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CAPB cDNA ORF Clone, Human;CAPPB cDNA ORF Clone, Human;CAPZ cDNA ORF Clone, Human
CAPZB Background Information
Full Name
capping protein (actin filament) muscle Z-line, beta

CAPZB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CAPZB cDNA ORF Clone in Cloning Vector, Mouse MG51824-G
CAPZB cDNA ORF Clone, Mouse, untagged MG51824-UT
CAPZB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51824-ACG
CAPZB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51824-ACGLN
CAPZB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51824-ANG
CAPZB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51824-ACR
CAPZB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51824-ANR
CAPZB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51824-CF
CAPZB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51824-NF
CAPZB cDNA ORF Clone, Mouse, C-His tag MG51824-CH
CAPZB cDNA ORF Clone, Mouse, N-His tag MG51824-NH
CAPZB cDNA ORF Clone, Mouse, C-HA tag MG51824-CY
CAPZB cDNA ORF Clone, Mouse, N-HA tag MG51824-NY
CAPZB cDNA ORF Clone, Mouse, C-Myc tag MG51824-CM
CAPZB cDNA ORF Clone, Mouse, N-Myc tag MG51824-NM
CAPZB qPCR Primer Pairs, Mouse MP201697

CAPZB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CAPZB cDNA ORF Clone in Cloning Vector, Human HG11627-M
CAPZB cDNA ORF Clone, Human, untagged HG11627-UT
CAPZB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11627-ACGLN
CAPZB cDNA ORF Clone, Human, C-GFPSpark® tag HG11627-ACG
CAPZB cDNA ORF Clone, Human, N-GFPSpark® tag HG11627-ANG
CAPZB cDNA ORF Clone, Human, C-OFPSpark® tag HG11627-ACR
CAPZB cDNA ORF Clone, Human, N-OFPSpark® tag HG11627-ANR
CAPZB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11627-NF
CAPZB cDNA ORF Clone, Human, C-His tag HG11627-CH
CAPZB cDNA ORF Clone, Human, N-His tag HG11627-NH
CAPZB cDNA ORF Clone, Human, C-HA tag HG11627-CY
CAPZB cDNA ORF Clone, Human, N-HA tag HG11627-NY
CAPZB cDNA ORF Clone, Human, C-Myc tag HG11627-CM
CAPZB cDNA ORF Clone, Human, N-Myc tag HG11627-NM
CAPZB qPCR Primer Pairs, Human HP101480
info info
添加购物车成功! 添加购物车失败!