BZW1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16318-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All BZW1 Reagents

CRO Services

Product recommended


All BZW1 Reagents

BZW1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1299 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human basic leucine zipper and W2 domains 1 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI(6kb+1.3kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BZW1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BZW1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images

Human STAT3 Gene Plasmid Map 5651

BZW1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

BZAP45 cDNA ORF Clone, Human;Nbla10236 cDNA ORF Clone, Human

BZW1 Background Information

Full Name
basic leucine zipper and W2 domains 1

BZW1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BZW1 cDNA ORF Clone in Cloning Vector, Rat RG81218-U
BZW1 cDNA ORF Clone, Rat, untagged RG81218-UT
BZW1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81218-ACGLN
BZW1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81218-ACG
BZW1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81218-ANG
BZW1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81218-ACR
BZW1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81218-ANR
BZW1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81218-CF
BZW1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81218-NF
BZW1 cDNA ORF Clone, Rat, C-His tag RG81218-CH
BZW1 cDNA ORF Clone, Rat, N-His tag RG81218-NH
BZW1 cDNA ORF Clone, Rat, C-HA tag RG81218-CY
BZW1 cDNA ORF Clone, Rat, N-HA tag RG81218-NY
BZW1 cDNA ORF Clone, Rat, C-Myc tag RG81218-CM
BZW1 cDNA ORF Clone, Rat, N-Myc tag RG81218-NM
BZW1 qPCR Primer Pairs, Rat RP301174

BZW1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BZW1 cDNA ORF Clone in Cloning Vector, Mouse MG53932-U
BZW1 cDNA ORF Clone, Mouse, untagged MG53932-UT
BZW1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53932-ACGLN
BZW1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53932-ACG
BZW1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53932-ANG
BZW1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53932-ACR
BZW1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53932-ANR
BZW1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53932-CF
BZW1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53932-NF
BZW1 cDNA ORF Clone, Mouse, C-His tag MG53932-CH
BZW1 cDNA ORF Clone, Mouse, N-His tag MG53932-NH
BZW1 cDNA ORF Clone, Mouse, C-HA tag MG53932-CY
BZW1 cDNA ORF Clone, Mouse, N-HA tag MG53932-NY
BZW1 cDNA ORF Clone, Mouse, C-Myc tag MG53932-CM
BZW1 cDNA ORF Clone, Mouse, N-Myc tag MG53932-NM

BZW1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BZW1 cDNA ORF Clone in Cloning Vector, Human HG16318-G
BZW1 cDNA ORF Clone, Human, untagged HG16318-UT
BZW1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16318-ACG
BZW1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16318-ACGLN
BZW1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16318-ANG
BZW1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16318-ACR
BZW1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16318-ANR
BZW1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16318-CF
BZW1 cDNA ORF Clone, Human, C-His tag HG16318-CH
BZW1 cDNA ORF Clone, Human, N-His tag HG16318-NH
BZW1 cDNA ORF Clone, Human, C-HA tag HG16318-CY
BZW1 cDNA ORF Clone, Human, N-HA tag HG16318-NY
BZW1 cDNA ORF Clone, Human, C-Myc tag HG16318-CM
BZW1 cDNA ORF Clone, Human, N-Myc tag HG16318-NM
BZW1 qPCR Primer Pairs, Human HP105072
info info
添加购物车成功! 添加购物车失败!