BTN3A1 cDNA ORF Clone, Human, N-His tag

Cat: HG15973-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BTN3A1 Reagents
CRO Services
Product recommended

All BTN3A1 Reagents
BTN3A1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1542 bp
Description
Full length Clone DNA of Human butyrophilin, subfamily 3, member A1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BTN3A1 cDNA ORF Clone, Human, N-His tag Alternative Names
BT3.1 cDNA ORF Clone, Human;BTF5 cDNA ORF Clone, Human;BTN3.1 cDNA ORF Clone, Human;CD277 cDNA ORF Clone, Human
BTN3A1 Background Information

BTN3A1 has the structure of a type I receptor of the Ig superfamily and is part of a family of seven BTN receptors encoded by genes in the MHC. BTN molecules are composed of two Ig domains (IgV, IgC2), a single transmembrane domain, and a large carboxyl-terminal domain termed B30.2 (or PRYSPRY) located in the cell cytoplasm. There are three human BTN3A loci, BTN3A1, BTN3A2, and BTN3A3, and clear orthologs of BTN3A molecules, now called CD277, are absent from the mouse genome. Despite its similarity to B7 molecules, BTN3A1 was proposed to act not as a coreceptor or costimulatory molecule, but rather to directly present pAg to the γδ TCR in a manner analogous to MHC-restricted peptide presentation. However, this model of BTN3A1 function has been challenged by conflicting data, which show pAg binding to a positively charged pocket in the cytosolic B30.2 domain, and that BTN3A1 does not directly engage the γδ TCR. This contradictory picture has emerged as a result of the complexity of the system and in particular by the use of endogenous and exogenous routes of Ag delivery in in vitro assays.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
butyrophilin subfamily 3 member A1
References
  • Rhodes DA, Chen H-C, Price AJ, et al. Activation of human γδ T cells by cytosolic interactions of BTN3A1 with soluble phosphoantigens and the cytoskeletal adaptor periplakin. Journal of immunology (Baltimore, Md : 1950). 2015;194(5):2390-2398.
  • info info
    添加购物车成功! 添加购物车失败!