BTF3 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11253-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BTF3 Reagents
CRO Services
Product recommended

All BTF3 Reagents
BTF3 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
621 bp
Description
Full length Clone DNA of Human basic transcription factor 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BTF3 cDNA ORF Clone, Human, C-Myc tag Alternative Names
BETA-NAC cDNA ORF Clone, Human;BTF3a cDNA ORF Clone, Human;BTF3b cDNA ORF Clone, Human;NACB cDNA ORF Clone, Human
BTF3 Background Information
Full Name
basic transcription factor 3

BTF3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BTF3 cDNA ORF Clone in Cloning Vector, Rat RG80763-U
BTF3 cDNA ORF Clone, Rat, untagged RG80763-UT
BTF3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80763-ACG
BTF3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80763-ACGLN
BTF3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80763-ANG
BTF3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80763-ACR
BTF3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80763-ANR
BTF3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80763-CF
BTF3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80763-NF
BTF3 cDNA ORF Clone, Rat, C-His tag RG80763-CH
BTF3 cDNA ORF Clone, Rat, N-His tag RG80763-NH
BTF3 cDNA ORF Clone, Rat, C-HA tag RG80763-CY
BTF3 cDNA ORF Clone, Rat, N-HA tag RG80763-NY
BTF3 cDNA ORF Clone, Rat, C-Myc tag RG80763-CM
BTF3 cDNA ORF Clone, Rat, N-Myc tag RG80763-NM
BTF3 qPCR Primer Pairs, Rat RP300727

BTF3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BTF3 cDNA ORF Clone in Cloning Vector, Mouse MG52111-G
BTF3 cDNA ORF Clone, Mouse, untagged MG52111-UT
BTF3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52111-ACGLN
BTF3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52111-ACG
BTF3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52111-ANG
BTF3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52111-ACR
BTF3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52111-ANR
BTF3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52111-CF
BTF3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52111-NF
BTF3 cDNA ORF Clone, Mouse, C-His tag MG52111-CH
BTF3 cDNA ORF Clone, Mouse, N-His tag MG52111-NH
BTF3 cDNA ORF Clone, Mouse, C-HA tag MG52111-CY
BTF3 cDNA ORF Clone, Mouse, N-HA tag MG52111-NY
BTF3 cDNA ORF Clone, Mouse, C-Myc tag MG52111-CM
BTF3 cDNA ORF Clone, Mouse, N-Myc tag MG52111-NM
BTF3 qPCR Primer Pairs, Mouse MP201984

BTF3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BTF3 cDNA ORF Clone in Cloning Vector, Human HG11253-M
BTF3 cDNA ORF Clone, Human, untagged HG11253-UT
BTF3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11253-ACG
BTF3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11253-ACGLN
BTF3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11253-ANG
BTF3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11253-ACR
BTF3 cDNA ORF Clone, Human, N-OFPSpark® tag HG11253-ANR
BTF3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11253-CF
BTF3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11253-NF
BTF3 cDNA ORF Clone, Human, C-His tag HG11253-CH
BTF3 cDNA ORF Clone, Human, N-His tag HG11253-NH
BTF3 cDNA ORF Clone, Human, C-HA tag HG11253-CY
BTF3 cDNA ORF Clone, Human, N-HA tag HG11253-NY
BTF3 cDNA ORF Clone, Human, N-Myc tag HG11253-NM
BTF3 qPCR Primer Pairs, Human HP101137
info info
添加购物车成功! 添加购物车失败!