BRK1/C3orf10 cDNA ORF Clone, Human, C-HA tag

Cat: HG16389-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BRK1/C3orf10 Reagents
CRO Services
Product recommended

All BRK1/C3orf10 Reagents
BRK1/C3orf10 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
228 bp
Description
Full length Clone DNA of Human BRICK1, SCAR/WAVE actin-nucleating complex subunit with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BRK1/C3orf10 cDNA ORF Clone, Human, C-HA tag Alternative Names
C3orf10 cDNA ORF Clone, Human;hHBrk1 cDNA ORF Clone, Human;HSPC300 cDNA ORF Clone, Human;MDS027 cDNA ORF Clone, Human
BRK1/C3orf10 Background Information
Full Name
BRICK1, SCAR/WAVE actin-nucleating complex subunit

BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
BRK1/C3orf10 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90816-G
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, untagged CG90816-UT
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90816-ACG
BRK1/C3orf10 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90816-ACGLN
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90816-ANG
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90816-ACR
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90816-ANR
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90816-CF
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90816-NF
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, C-His tag CG90816-CH
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, N-His tag CG90816-NH
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, C-HA tag CG90816-CY
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, N-HA tag CG90816-NY
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90816-CM
BRK1/C3orf10 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90816-NM

BRK1/C3orf10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BRK1/C3orf10 cDNA ORF Clone in Cloning Vector, Rat RG80794-U
BRK1/C3orf10 cDNA ORF Clone, Rat, untagged RG80794-UT
BRK1/C3orf10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80794-ACG
BRK1/C3orf10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80794-ACGLN
BRK1/C3orf10 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80794-ANG
BRK1/C3orf10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80794-ACR
BRK1/C3orf10 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80794-ANR
BRK1/C3orf10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80794-CF
BRK1/C3orf10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80794-NF
BRK1/C3orf10 cDNA ORF Clone, Rat, C-His tag RG80794-CH
BRK1/C3orf10 cDNA ORF Clone, Rat, N-His tag RG80794-NH
BRK1/C3orf10 cDNA ORF Clone, Rat, C-HA tag RG80794-CY
BRK1/C3orf10 cDNA ORF Clone, Rat, N-HA tag RG80794-NY
BRK1/C3orf10 cDNA ORF Clone, Rat, C-Myc tag RG80794-CM
BRK1/C3orf10 cDNA ORF Clone, Rat, N-Myc tag RG80794-NM
BRK1/C3orf10 qPCR Primer Pairs, Rat RP300758

BRK1/C3orf10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BRK1/C3orf10 cDNA ORF Clone in Cloning Vector, Mouse MG52433-G
BRK1/C3orf10 cDNA ORF Clone, Mouse, untagged MG52433-UT
BRK1/C3orf10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52433-ACGLN
BRK1/C3orf10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52433-ACG
BRK1/C3orf10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52433-ANG
BRK1/C3orf10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52433-ACR
BRK1/C3orf10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52433-ANR
BRK1/C3orf10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52433-CF
BRK1/C3orf10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52433-NF
BRK1/C3orf10 cDNA ORF Clone, Mouse, C-His tag MG52433-CH
BRK1/C3orf10 cDNA ORF Clone, Mouse, N-His tag MG52433-NH
BRK1/C3orf10 cDNA ORF Clone, Mouse, C-HA tag MG52433-CY
BRK1/C3orf10 cDNA ORF Clone, Mouse, N-HA tag MG52433-NY
BRK1/C3orf10 cDNA ORF Clone, Mouse, C-Myc tag MG52433-CM
BRK1/C3orf10 cDNA ORF Clone, Mouse, N-Myc tag MG52433-NM
BRK1/C3orf10 qPCR Primer Pairs, Mouse MP202306

BRK1/C3orf10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BRK1/C3orf10 cDNA ORF Clone in Cloning Vector, Human HG16389-G
BRK1/C3orf10 cDNA ORF Clone, Human, untagged HG16389-UT
BRK1/C3orf10 cDNA ORF Clone, Human, C-GFPSpark® tag HG16389-ACG
BRK1/C3orf10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16389-ACGLN
BRK1/C3orf10 cDNA ORF Clone, Human, N-GFPSpark® tag HG16389-ANG
BRK1/C3orf10 cDNA ORF Clone, Human, C-OFPSpark® tag HG16389-ACR
BRK1/C3orf10 cDNA ORF Clone, Human, N-OFPSpark® tag HG16389-ANR
BRK1/C3orf10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16389-CF
BRK1/C3orf10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16389-NF
BRK1/C3orf10 cDNA ORF Clone, Human, C-His tag HG16389-CH
BRK1/C3orf10 cDNA ORF Clone, Human, N-His tag HG16389-NH
BRK1/C3orf10 cDNA ORF Clone, Human, N-HA tag HG16389-NY
BRK1/C3orf10 cDNA ORF Clone, Human, C-Myc tag HG16389-CM
BRK1/C3orf10 cDNA ORF Clone, Human, N-Myc tag HG16389-NM
BRK1/C3orf10 qPCR Primer Pairs, Human HP105138
info info
添加购物车成功! 添加购物车失败!