BRIX1/BXDC2 cDNA ORF Clone, Human, N-His tag

Cat: HG11391-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BRIX1/BXDC2 Reagents
CRO Services
Product recommended

All BRIX1/BXDC2 Reagents
BRIX1/BXDC2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1062 bp
Description
Full length Clone DNA of Human BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BRIX1/BXDC2 cDNA ORF Clone, Human, N-His tag Alternative Names
BRIX cDNA ORF Clone, Human;BXDC2 cDNA ORF Clone, Human
BRIX1/BXDC2 Background Information
Full Name
BRX1, biogenesis of ribosomes

BRIX1/BXDC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BRIX1/BXDC2 cDNA ORF Clone in Cloning Vector, Mouse MG53432-U
BRIX1/BXDC2 cDNA ORF Clone, Mouse, untagged MG53432-UT
BRIX1/BXDC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53432-ACG
BRIX1/BXDC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53432-ACGLN
BRIX1/BXDC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53432-ANG
BRIX1/BXDC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53432-ACR
BRIX1/BXDC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53432-ANR
BRIX1/BXDC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53432-CF
BRIX1/BXDC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53432-NF
BRIX1/BXDC2 cDNA ORF Clone, Mouse, C-His tag MG53432-CH
BRIX1/BXDC2 cDNA ORF Clone, Mouse, N-His tag MG53432-NH
BRIX1/BXDC2 cDNA ORF Clone, Mouse, C-HA tag MG53432-CY
BRIX1/BXDC2 cDNA ORF Clone, Mouse, N-HA tag MG53432-NY
BRIX1/BXDC2 cDNA ORF Clone, Mouse, C-Myc tag MG53432-CM
BRIX1/BXDC2 cDNA ORF Clone, Mouse, N-Myc tag MG53432-NM

BRIX1/BXDC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BRIX1/BXDC2 cDNA ORF Clone in Cloning Vector, Human HG11391-M
BRIX1/BXDC2 cDNA ORF Clone, Human, untagged HG11391-UT
BRIX1/BXDC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11391-ACGLN
BRIX1/BXDC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11391-ACG
BRIX1/BXDC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11391-ANG
BRIX1/BXDC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11391-ACR
BRIX1/BXDC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11391-ANR
BRIX1/BXDC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11391-CF
BRIX1/BXDC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11391-NF
BRIX1/BXDC2 cDNA ORF Clone, Human, C-His tag HG11391-CH
BRIX1/BXDC2 cDNA ORF Clone, Human, C-HA tag HG11391-CY
BRIX1/BXDC2 cDNA ORF Clone, Human, N-HA tag HG11391-NY
BRIX1/BXDC2 cDNA ORF Clone, Human, C-Myc tag HG11391-CM
BRIX1/BXDC2 cDNA ORF Clone, Human, N-Myc tag HG11391-NM
BRIX1/BXDC2 qPCR Primer Pairs, Human HP101268
info info
添加购物车成功! 添加购物车失败!