B Raf cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11632-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All B Raf Reagents
CRO Services
Product recommended

All B Raf Reagents
B Raf cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2340 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-raf murine sarcoma viral oncogene homolog B1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
HindIII + NotI(6kb+2.34kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
B Raf cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

B Raf cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human STAT3 Gene Plasmid Map 5680
B Raf cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
B-RAF1 cDNA ORF Clone, Human;BRAF1 cDNA ORF Clone, Human;NS7 cDNA ORF Clone, Human;RAFB1 cDNA ORF Clone, Human
B Raf Background Information

BRAF gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. BRAFprotein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in BRAF gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in BRAF gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
B-Raf proto-oncogene, serine/threonine kinase
References
  • Weston-Bell NJ, Tapper W, Gibson J, et al. Exome Sequencing in Classic Hairy Cell Leukaemia Reveals Widespread Variation in Acquired Somatic Mutations between Individual Tumours Apart from the Signature BRAF V(600)E Lesion. Richards KL, ed. PLoS ONE. 2016;11(2):e0149162. doi:10.1371/journal.pone.0149162.
  • info info
    添加购物车成功! 添加购物车失败!