BAALC cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14429-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BAALC Reagents
CRO Services
Product recommended

All BAALC Reagents
BAALC cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
438 bp
Description
Full length Clone DNA of Human brain and acute leukemia, cytoplasmic with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BAALC Background Information
Full Name
brain and acute leukemia, cytoplasmic

BAALC cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
BAALC cDNA ORF Clone in Cloning Vector, Ferret FG60043-G
BAALC cDNA ORF Clone, Ferret, untagged FG60043-UT
BAALC Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60043-ACGLN
BAALC cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60043-ACG
BAALC cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60043-ANG
BAALC cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60043-ACR
BAALC cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60043-ANR
BAALC cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60043-CF
BAALC cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60043-NF
BAALC cDNA ORF Clone, Ferret, C-His tag FG60043-CH
BAALC cDNA ORF Clone, Ferret, N-His tag FG60043-NH
BAALC cDNA ORF Clone, Ferret, C-HA tag FG60043-CY
BAALC cDNA ORF Clone, Ferret, N-HA tag FG60043-NY
BAALC cDNA ORF Clone, Ferret, C-Myc tag FG60043-CM
BAALC cDNA ORF Clone, Ferret, N-Myc tag FG60043-NM

BAALC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BAALC cDNA ORF Clone in Cloning Vector, Human HG14429-G
BAALC cDNA ORF Clone, Human, untagged HG14429-UT
BAALC cDNA ORF Clone, Human, C-GFPSpark® tag HG14429-ACG
BAALC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14429-ACGLN
BAALC cDNA ORF Clone, Human, N-GFPSpark® tag HG14429-ANG
BAALC cDNA ORF Clone, Human, C-OFPSpark® tag HG14429-ACR
BAALC cDNA ORF Clone, Human, N-OFPSpark® tag HG14429-ANR
BAALC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14429-NF
BAALC cDNA ORF Clone, Human, C-His tag HG14429-CH
BAALC cDNA ORF Clone, Human, N-His tag HG14429-NH
BAALC cDNA ORF Clone, Human, C-HA tag HG14429-CY
BAALC cDNA ORF Clone, Human, N-HA tag HG14429-NY
BAALC cDNA ORF Clone, Human, C-Myc tag HG14429-CM
BAALC cDNA ORF Clone, Human, N-Myc tag HG14429-NM
BAALC qPCR Primer Pairs, Human HP103077
info info
添加购物车成功! 添加购物车失败!