ATP6V1F cDNA ORF Clone, Human, C-Myc tag

Cat: HG15605-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ATP6V1F Reagents
CRO Services
Product recommended

All ATP6V1F Reagents
ATP6V1F cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
360 bp
Description
Full length Clone DNA of Human ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP6V1F cDNA ORF Clone, Human, C-Myc tag Alternative Names
ATP6S14 cDNA ORF Clone, Human;VATF cDNA ORF Clone, Human;Vma7 cDNA ORF Clone, Human
ATP6V1F Background Information
Full Name
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F

ATP6V1F cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP6V1F cDNA ORF Clone in Cloning Vector, Rat RG81686-G
ATP6V1F cDNA ORF Clone, Rat, untagged RG81686-UT
ATP6V1F cDNA ORF Clone, Rat, C-GFPSpark® tag RG81686-ACG
ATP6V1F Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81686-ACGLN
ATP6V1F cDNA ORF Clone, Rat, N-GFPSpark® tag RG81686-ANG
ATP6V1F cDNA ORF Clone, Rat, C-OFPSpark® tag RG81686-ACR
ATP6V1F cDNA ORF Clone, Rat, N-OFPSpark® tag RG81686-ANR
ATP6V1F cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81686-CF
ATP6V1F cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81686-NF
ATP6V1F cDNA ORF Clone, Rat, C-His tag RG81686-CH
ATP6V1F cDNA ORF Clone, Rat, N-His tag RG81686-NH
ATP6V1F cDNA ORF Clone, Rat, C-HA tag RG81686-CY
ATP6V1F cDNA ORF Clone, Rat, N-HA tag RG81686-NY
ATP6V1F cDNA ORF Clone, Rat, C-Myc tag RG81686-CM
ATP6V1F cDNA ORF Clone, Rat, N-Myc tag RG81686-NM

ATP6V1F cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP6V1F cDNA ORF Clone in Cloning Vector, Human HG15605-G
ATP6V1F cDNA ORF Clone, Human, untagged HG15605-UT
ATP6V1F Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15605-ACGLN
ATP6V1F cDNA ORF Clone, Human, C-GFPSpark® tag HG15605-ACG
ATP6V1F cDNA ORF Clone, Human, N-GFPSpark® tag HG15605-ANG
ATP6V1F cDNA ORF Clone, Human, C-OFPSpark® tag HG15605-ACR
ATP6V1F cDNA ORF Clone, Human, N-OFPSpark® tag HG15605-ANR
ATP6V1F cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15605-CF
ATP6V1F cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15605-NF
ATP6V1F cDNA ORF Clone, Human, C-His tag HG15605-CH
ATP6V1F cDNA ORF Clone, Human, N-His tag HG15605-NH
ATP6V1F cDNA ORF Clone, Human, C-HA tag HG15605-CY
ATP6V1F cDNA ORF Clone, Human, N-HA tag HG15605-NY
ATP6V1F cDNA ORF Clone, Human, N-Myc tag HG15605-NM
ATP6V1F qPCR Primer Pairs, Human HP104224
info info
添加购物车成功! 添加购物车失败!