ATP6V0E cDNA ORF Clone, Human, untagged

Cat: HG16151-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ATP6V0E Reagents
CRO Services
Product recommended

All ATP6V0E Reagents
ATP6V0E cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
246 bp
Description
Full length Clone DNA of Human ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP6V0E cDNA ORF Clone, Human, untagged Alternative Names
ATP6H cDNA ORF Clone, Human;ATP6V0E cDNA ORF Clone, Human;M9.2 cDNA ORF Clone, Human;Vma21 cDNA ORF Clone, Human;Vma21p cDNA ORF Clone, Human
ATP6V0E Background Information
Full Name
ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1

ATP6V0E cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
ATP6V0E cDNA ORF Clone in Cloning Vector, Ferret FG60114-G
ATP6V0E cDNA ORF Clone, Ferret, untagged FG60114-UT
ATP6V0E cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60114-ACG
ATP6V0E Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60114-ACGLN
ATP6V0E cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60114-ANG
ATP6V0E cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60114-ACR
ATP6V0E cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60114-ANR
ATP6V0E cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60114-CF
ATP6V0E cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60114-NF
ATP6V0E cDNA ORF Clone, Ferret, C-His tag FG60114-CH
ATP6V0E cDNA ORF Clone, Ferret, N-His tag FG60114-NH
ATP6V0E cDNA ORF Clone, Ferret, C-HA tag FG60114-CY
ATP6V0E cDNA ORF Clone, Ferret, N-HA tag FG60114-NY
ATP6V0E cDNA ORF Clone, Ferret, C-Myc tag FG60114-CM
ATP6V0E cDNA ORF Clone, Ferret, N-Myc tag FG60114-NM

ATP6V0E cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP6V0E cDNA ORF Clone in Cloning Vector, Rat RG80831-U
ATP6V0E cDNA ORF Clone, Rat, untagged RG80831-UT
ATP6V0E Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80831-ACGLN
ATP6V0E cDNA ORF Clone, Rat, C-GFPSpark® tag RG80831-ACG
ATP6V0E cDNA ORF Clone, Rat, N-GFPSpark® tag RG80831-ANG
ATP6V0E cDNA ORF Clone, Rat, C-OFPSpark® tag RG80831-ACR
ATP6V0E cDNA ORF Clone, Rat, N-OFPSpark® tag RG80831-ANR
ATP6V0E cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80831-CF
ATP6V0E cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80831-NF
ATP6V0E cDNA ORF Clone, Rat, C-His tag RG80831-CH
ATP6V0E cDNA ORF Clone, Rat, N-His tag RG80831-NH
ATP6V0E cDNA ORF Clone, Rat, C-HA tag RG80831-CY
ATP6V0E cDNA ORF Clone, Rat, N-HA tag RG80831-NY
ATP6V0E cDNA ORF Clone, Rat, C-Myc tag RG80831-CM
ATP6V0E cDNA ORF Clone, Rat, N-Myc tag RG80831-NM
ATP6V0E qPCR Primer Pairs, Rat RP300795

ATP6V0E cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP6V0E cDNA ORF Clone in Cloning Vector, Human HG16151-G
ATP6V0E Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16151-ACGLN
ATP6V0E cDNA ORF Clone, Human, C-GFPSpark® tag HG16151-ACG
ATP6V0E cDNA ORF Clone, Human, C-OFPSpark® tag HG16151-ACR
ATP6V0E cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16151-CF
ATP6V0E cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16151-NF
ATP6V0E cDNA ORF Clone, Human, C-His tag HG16151-CH
ATP6V0E cDNA ORF Clone, Human, N-His tag HG16151-NH
ATP6V0E cDNA ORF Clone, Human, C-HA tag HG16151-CY
ATP6V0E cDNA ORF Clone, Human, N-HA tag HG16151-NY
ATP6V0E cDNA ORF Clone, Human, C-Myc tag HG16151-CM
ATP6V0E cDNA ORF Clone, Human, N-Myc tag HG16151-NM
ATP6V0E qPCR Primer Pairs, Human HP104920
info info
添加购物车成功! 添加购物车失败!