Asporin/ASPN cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13308-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Asporin/ASPN Reagents
CRO Services
Product recommended

All Asporin/ASPN Reagents
Asporin/ASPN cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1140 bp
Description
Full length Clone DNA of Human asporin with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Asporin/ASPN cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
OS3 cDNA ORF Clone, Human;PLAP-1 cDNA ORF Clone, Human;PLAP1 cDNA ORF Clone, Human;SLRR1C cDNA ORF Clone, Human
Asporin/ASPN Background Information
Full Name
asporin

Asporin/ASPN cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Asporin/ASPN cDNA ORF Clone in Cloning Vector, Rat RG8A1356-U
Asporin/ASPN Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1356-ACGLN

Asporin/ASPN cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Asporin/ASPN cDNA ORF Clone in Cloning Vector, Mouse MG5A0122-U
Asporin/ASPN cDNA ORF Clone, Mouse, untagged MG5A0122-UT
Asporin/ASPN cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0122-ACG
Asporin/ASPN Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0122-ACGLN
Asporin/ASPN cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0122-ACR
Asporin/ASPN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0122-CF
Asporin/ASPN cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0122-NF
Asporin/ASPN cDNA ORF Clone, Mouse, C-His tag MG5A0122-CH
Asporin/ASPN cDNA ORF Clone, Mouse, N-His tag MG5A0122-NH
Asporin/ASPN cDNA ORF Clone, Mouse, C-HA tag MG5A0122-CY
Asporin/ASPN cDNA ORF Clone, Mouse, N-HA tag MG5A0122-NY
Asporin/ASPN cDNA ORF Clone, Mouse, C-Myc tag MG5A0122-CM
Asporin/ASPN cDNA ORF Clone, Mouse, N-Myc tag MG5A0122-NM

Asporin/ASPN cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Asporin/ASPN cDNA ORF Clone in Cloning Vector, Human HG13308-G
Asporin/ASPN cDNA ORF Clone, Human, untagged HG13308-UT
Asporin/ASPN Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13308-ACGLN
Asporin/ASPN cDNA ORF Clone, Human, C-GFPSpark® tag HG13308-ACG
Asporin/ASPN cDNA ORF Clone, Human, C-OFPSpark® tag HG13308-ACR
Asporin/ASPN cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13308-NF
Asporin/ASPN cDNA ORF Clone, Human, C-His tag HG13308-CH
Asporin/ASPN cDNA ORF Clone, Human, N-His tag HG13308-NH
Asporin/ASPN cDNA ORF Clone, Human, C-HA tag HG13308-CY
Asporin/ASPN cDNA ORF Clone, Human, N-HA tag HG13308-NY
Asporin/ASPN cDNA ORF Clone, Human, C-Myc tag HG13308-CM
Asporin/ASPN cDNA ORF Clone, Human, N-Myc tag HG13308-NM
Asporin/ASPN qPCR Primer Pairs, Human HP102014
info info
添加购物车成功! 添加购物车失败!