BMAL1/ARNTL cDNA ORF Clone, Human, N-HA tag

Cat: HG15193-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BMAL1/ARNTL Reagents
CRO Services
Product recommended

All BMAL1/ARNTL Reagents
BMAL1/ARNTL cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1878 bp
Description
Full length Clone DNA of Human aryl hydrocarbon receptor nuclear translocator-like with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMAL1/ARNTL cDNA ORF Clone, Human, N-HA tag Alternative Names
bHLHe5 cDNA ORF Clone, Human;BMAL1 cDNA ORF Clone, Human;BMAL1c cDNA ORF Clone, Human;JAP3 cDNA ORF Clone, Human;MOP3 cDNA ORF Clone, Human;PASD3 cDNA ORF Clone, Human;TIC cDNA ORF Clone, Human
BMAL1/ARNTL Background Information
Full Name
aryl hydrocarbon receptor nuclear translocator-like

BMAL1/ARNTL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BMAL1/ARNTL cDNA ORF Clone in Cloning Vector, Mouse MG57171-U
BMAL1/ARNTL cDNA ORF Clone, Mouse, untagged MG57171-UT
BMAL1/ARNTL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57171-ACGLN
BMAL1/ARNTL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57171-ACG
BMAL1/ARNTL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57171-ANG
BMAL1/ARNTL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57171-ACR
BMAL1/ARNTL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57171-ANR
BMAL1/ARNTL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57171-CF
BMAL1/ARNTL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57171-NF
BMAL1/ARNTL cDNA ORF Clone, Mouse, C-His tag MG57171-CH
BMAL1/ARNTL cDNA ORF Clone, Mouse, N-His tag MG57171-NH
BMAL1/ARNTL cDNA ORF Clone, Mouse, C-HA tag MG57171-CY
BMAL1/ARNTL cDNA ORF Clone, Mouse, N-HA tag MG57171-NY
BMAL1/ARNTL cDNA ORF Clone, Mouse, C-Myc tag MG57171-CM
BMAL1/ARNTL cDNA ORF Clone, Mouse, N-Myc tag MG57171-NM

BMAL1/ARNTL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BMAL1/ARNTL cDNA ORF Clone in Cloning Vector, Human HG15193-G
BMAL1/ARNTL cDNA ORF Clone, Human, untagged HG15193-UT
BMAL1/ARNTL cDNA ORF Clone, Human, C-GFPSpark® tag HG15193-ACG
BMAL1/ARNTL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15193-ACGLN
BMAL1/ARNTL cDNA ORF Clone, Human, N-GFPSpark® tag HG15193-ANG
BMAL1/ARNTL cDNA ORF Clone, Human, C-OFPSpark® tag HG15193-ACR
BMAL1/ARNTL cDNA ORF Clone, Human, N-OFPSpark® tag HG15193-ANR
BMAL1/ARNTL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15193-CF
BMAL1/ARNTL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15193-NF
BMAL1/ARNTL cDNA ORF Clone, Human, C-His tag HG15193-CH
BMAL1/ARNTL cDNA ORF Clone, Human, N-His tag HG15193-NH
BMAL1/ARNTL cDNA ORF Clone, Human, C-HA tag HG15193-CY
BMAL1/ARNTL cDNA ORF Clone, Human, C-Myc tag HG15193-CM
BMAL1/ARNTL cDNA ORF Clone, Human, N-Myc tag HG15193-NM
BMAL1/ARNTL qPCR Primer Pairs, Human HP103819
info info
添加购物车成功! 添加购物车失败!