AP2M1 cDNA ORF Clone, Human, untagged

Cat: HG16144-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AP2M1 Reagents
CRO Services
Product recommended

All AP2M1 Reagents
AP2M1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human adaptor-related protein complex 2, mu 1 subunit.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
HindIII + NotI (6.1kb + 1.31kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
AP2M1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AP2M1 cDNA ORF Clone, Human, untagged Alternative Names
AP50 cDNA ORF Clone, Human;CLAPM1 cDNA ORF Clone, Human;mu2 cDNA ORF Clone, Human
AP2M1 Background Information
Full Name
adaptor-related protein complex 2, mu 1 subunit

AP2M1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
AP2M1 cDNA ORF Clone in Cloning Vector, Canine DG70220-U
AP2M1 cDNA ORF Clone, Canine, untagged DG70220-UT
AP2M1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70220-ACGLN
AP2M1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70220-ACG
AP2M1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70220-ANG
AP2M1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70220-ACR
AP2M1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70220-ANR
AP2M1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70220-CF
AP2M1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70220-NF
AP2M1 cDNA ORF Clone, Canine, C-His tag DG70220-CH
AP2M1 cDNA ORF Clone, Canine, N-His tag DG70220-NH
AP2M1 cDNA ORF Clone, Canine, C-HA tag DG70220-CY
AP2M1 cDNA ORF Clone, Canine, N-HA tag DG70220-NY
AP2M1 cDNA ORF Clone, Canine, C-Myc tag DG70220-CM
AP2M1 cDNA ORF Clone, Canine, N-Myc tag DG70220-NM

AP2M1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AP2M1 cDNA ORF Clone in Cloning Vector, Rat RG80622-G
AP2M1 cDNA ORF Clone, Rat, untagged RG80622-UT
AP2M1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80622-ACG
AP2M1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80622-ACGLN
AP2M1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80622-ACR
AP2M1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80622-CF
AP2M1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80622-NF
AP2M1 cDNA ORF Clone, Rat, C-His tag RG80622-CH
AP2M1 cDNA ORF Clone, Rat, N-His tag RG80622-NH
AP2M1 cDNA ORF Clone, Rat, C-HA tag RG80622-CY
AP2M1 cDNA ORF Clone, Rat, N-HA tag RG80622-NY
AP2M1 cDNA ORF Clone, Rat, C-Myc tag RG80622-CM
AP2M1 cDNA ORF Clone, Rat, N-Myc tag RG80622-NM
AP2M1 qPCR Primer Pairs, Rat RP300586

AP2M1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AP2M1 cDNA ORF Clone in Cloning Vector, Mouse MG53170-G
AP2M1 cDNA ORF Clone, Mouse, untagged MG53170-UT
AP2M1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53170-ACG
AP2M1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53170-ACGLN
AP2M1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53170-ACR
AP2M1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53170-CF
AP2M1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53170-NF
AP2M1 cDNA ORF Clone, Mouse, C-His tag MG53170-CH
AP2M1 cDNA ORF Clone, Mouse, N-His tag MG53170-NH
AP2M1 cDNA ORF Clone, Mouse, C-HA tag MG53170-CY
AP2M1 cDNA ORF Clone, Mouse, N-HA tag MG53170-NY
AP2M1 cDNA ORF Clone, Mouse, C-Myc tag MG53170-CM
AP2M1 cDNA ORF Clone, Mouse, N-Myc tag MG53170-NM

AP2M1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AP2M1 cDNA ORF Clone in Cloning Vector, Human HG16144-G
AP2M1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16144-ACG
AP2M1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16144-ACGLN
AP2M1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16144-ACR
AP2M1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16144-CF
AP2M1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16144-NF
AP2M1 cDNA ORF Clone, Human, C-His tag HG16144-CH
AP2M1 cDNA ORF Clone, Human, N-His tag HG16144-NH
AP2M1 cDNA ORF Clone, Human, C-HA tag HG16144-CY
AP2M1 cDNA ORF Clone, Human, N-HA tag HG16144-NY
AP2M1 cDNA ORF Clone, Human, C-Myc tag HG16144-CM
AP2M1 cDNA ORF Clone, Human, N-Myc tag HG16144-NM
AP2M1 qPCR Primer Pairs, Human HP104737
info info
添加购物车成功! 添加购物车失败!