ALDH1A3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11636-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ALDH1A3 Reagents
CRO Services
Product recommended

All ALDH1A3 Reagents
ALDH1A3 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1578 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1530 G/A and 1536 C/A not causing the amino acid variation.
Description
Full length Clone DNA of Human aldehyde dehydrogenase 1 family, member A3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Flag
Restriction Sites
KpnI+XbaI(6kb+1.58kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ALDH1A3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALDH1A3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human ALDH1A3/RALDH3 Gene Expression validated Image 14331
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
ALDH1A3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ALDH1A6 cDNA ORF Clone, Human;ALDH6 cDNA ORF Clone, Human;MCOP8 cDNA ORF Clone, Human;RALDH3 cDNA ORF Clone, Human
ALDH1A3 Background Information

Aldehyde dehydrogenase 1 family, member A3 (ALDH1A3), also known as Retinaldehyde dehydrogenase 3 (RALDH3), which belongs to the aldehyde dehydrogenase family. ALDH1A3 is a novel Cancer stem cell (CSC) marker with potential clinical prognostic applicability, and demonstrates a clear correlation between CSC prevalence and the development of metastatic breast cancer. The retinoic acid (RA) biosynthesis enzyme aldehyde dehydrogenase 1A3 (ALDH1A3) is a putative androgen-responsive gene in human prostate cancer epithelial (LNCaP) cells. The RA biosynthesis enzyme ALDH1A3 is androgen responsive and (ii) DHT up-regulation of ALDH1A3 can increase the oxidation of retinal to RA and indirectly affect RA bioactivity and metabolism.

Full Name
aldehyde dehydrogenase 1 family, member A3
References
  • Marcato P, et al. (2011) Aldehyde dehydrogenase activity of breast cancer stem cells is primarily due to isoform ALDH1A3 and its expression is predictive of metastasis. Stem Cells. 29(1)32-45.
  • Trasino SE, et al. (2007) Androgen regulation of aldehyde dehydrogenase 1A3 (ALDH1A3) in the androgen-responsive human prostate cancer cell line LNCaP. Exp Biol Med (Maywood). 232(6): 762-71.
  • info info
    添加购物车成功! 添加购物车失败!