AICDA cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15667-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AICDA Reagents
CRO Services
Product recommended

All AICDA Reagents
AICDA cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
597 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human activation-induced cytidine deaminase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb+0.64kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
AICDA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AICDA cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human AICDA Gene Expression validated Image 14350
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
AICDA cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
AID cDNA ORF Clone, Human;ARP2 cDNA ORF Clone, Human;CDA2 cDNA ORF Clone, Human;HEL-S-284 cDNA ORF Clone, Human;HIGM2 cDNA ORF Clone, Human
AICDA Background Information
Full Name
activation-induced cytidine deaminase

AICDA cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
AICDA cDNA ORF Clone in Cloning Vector, Ferret FG60152-G
AICDA cDNA ORF Clone, Ferret, untagged FG60152-UT
AICDA Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60152-ACGLN
AICDA cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60152-ACG
AICDA cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60152-ANG
AICDA cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60152-ACR
AICDA cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60152-ANR
AICDA cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60152-CF
AICDA cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60152-NF
AICDA cDNA ORF Clone, Ferret, C-His tag FG60152-CH
AICDA cDNA ORF Clone, Ferret, N-His tag FG60152-NH
AICDA cDNA ORF Clone, Ferret, C-HA tag FG60152-CY
AICDA cDNA ORF Clone, Ferret, N-HA tag FG60152-NY
AICDA cDNA ORF Clone, Ferret, C-Myc tag FG60152-CM
AICDA cDNA ORF Clone, Ferret, N-Myc tag FG60152-NM

AICDA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AICDA cDNA ORF Clone in Cloning Vector, Human HG15667-G
AICDA cDNA ORF Clone, Human, untagged HG15667-UT
AICDA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15667-ACGLN
AICDA cDNA ORF Clone, Human, C-GFPSpark® tag HG15667-ACG
AICDA cDNA ORF Clone, Human, N-GFPSpark® tag HG15667-ANG
AICDA cDNA ORF Clone, Human, C-OFPSpark® tag HG15667-ACR
AICDA cDNA ORF Clone, Human, N-OFPSpark® tag HG15667-ANR
AICDA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15667-NF
AICDA cDNA ORF Clone, Human, C-His tag HG15667-CH
AICDA cDNA ORF Clone, Human, N-His tag HG15667-NH
AICDA cDNA ORF Clone, Human, C-HA tag HG15667-CY
AICDA cDNA ORF Clone, Human, N-HA tag HG15667-NY
AICDA cDNA ORF Clone, Human, C-Myc tag HG15667-CM
AICDA cDNA ORF Clone, Human, N-Myc tag HG15667-NM
AICDA qPCR Primer Pairs, Human HP104282
info info
添加购物车成功! 添加购物车失败!