SAHH/AHCY cDNA ORF Clone, Human, N-His tag

Cat: HG11384-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SAHH/AHCY Reagents
CRO Services
Product recommended

All SAHH/AHCY Reagents
SAHH/AHCY cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1299 bp
Description
Full length Clone DNA of Human adenosylhomocysteinase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SAHH/AHCY cDNA ORF Clone, Human, N-His tag Alternative Names
adoHcyase cDNA ORF Clone, Human;SAHH cDNA ORF Clone, Human
SAHH/AHCY Background Information
Full Name
adenosylhomocysteinase

SAHH/AHCY cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SAHH/AHCY cDNA ORF Clone in Cloning Vector, Rat RG82414-U
SAHH/AHCY Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82414-ACGLN

SAHH/AHCY cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SAHH/AHCY cDNA ORF Clone in Cloning Vector, Mouse MG51577-G
SAHH/AHCY cDNA ORF Clone, Mouse, untagged MG51577-UT
SAHH/AHCY Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51577-ACGLN
SAHH/AHCY cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51577-ACG
SAHH/AHCY cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51577-ANG
SAHH/AHCY cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51577-ACR
SAHH/AHCY cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51577-ANR
SAHH/AHCY cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51577-CF
SAHH/AHCY cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51577-NF
SAHH/AHCY cDNA ORF Clone, Mouse, C-His tag MG51577-CH
SAHH/AHCY cDNA ORF Clone, Mouse, N-His tag MG51577-NH
SAHH/AHCY cDNA ORF Clone, Mouse, C-HA tag MG51577-CY
SAHH/AHCY cDNA ORF Clone, Mouse, N-HA tag MG51577-NY
SAHH/AHCY cDNA ORF Clone, Mouse, C-Myc tag MG51577-CM
SAHH/AHCY cDNA ORF Clone, Mouse, N-Myc tag MG51577-NM
SAHH/AHCY qPCR Primer Pairs, Mouse MP201460

SAHH/AHCY cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SAHH/AHCY cDNA ORF Clone in Cloning Vector, Human HG11384-M
SAHH/AHCY cDNA ORF Clone, Human, untagged HG11384-UT
SAHH/AHCY Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11384-ACGLN
SAHH/AHCY cDNA ORF Clone, Human, C-GFPSpark® tag HG11384-ACG
SAHH/AHCY cDNA ORF Clone, Human, N-GFPSpark® tag HG11384-ANG
SAHH/AHCY cDNA ORF Clone, Human, C-OFPSpark® tag HG11384-ACR
SAHH/AHCY cDNA ORF Clone, Human, N-OFPSpark® tag HG11384-ANR
SAHH/AHCY cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11384-CF
SAHH/AHCY cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11384-NF
SAHH/AHCY cDNA ORF Clone, Human, C-His tag HG11384-CH
SAHH/AHCY cDNA ORF Clone, Human, C-HA tag HG11384-CY
SAHH/AHCY cDNA ORF Clone, Human, N-HA tag HG11384-NY
SAHH/AHCY cDNA ORF Clone, Human, C-Myc tag HG11384-CM
SAHH/AHCY cDNA ORF Clone, Human, N-Myc tag HG11384-NM
SAHH/AHCY qPCR Primer Pairs, Human HP101263
info info
添加购物车成功! 添加购物车失败!