Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10963-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Actin-like protein 6A/BAF53a Reagents
CRO Services
Product recommended

All Actin-like protein 6A/BAF53a Reagents
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1329 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1017C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human actin-like 6A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI(two restriction sites) + XbaI(6kb+1.22kb+0.12kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Actin-like protein 6A/BAF53a cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Actin-like protein 6A/BAF53a Gene Plasmid Map 19974
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ACTL6 cDNA ORF Clone, Human;Arp4 cDNA ORF Clone, Human;ARPN-BETA cDNA ORF Clone, Human;BAF53A cDNA ORF Clone, Human;INO80K cDNA ORF Clone, Human
Actin-like protein 6A/BAF53a Background Information
Full Name
actin-like 6A

Actin-like protein 6A/BAF53a cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Actin-like protein 6A/BAF53a cDNA ORF Clone in Cloning Vector, Rat RG8A0867-U
Actin-like protein 6A/BAF53a Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0867-ACGLN

Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Actin-like protein 6A/BAF53a cDNA ORF Clone in Cloning Vector, Human HG10963-M
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, untagged HG10963-UT
Actin-like protein 6A/BAF53a Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10963-ACGLN
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-GFPSpark® tag HG10963-ACG
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-GFPSpark® tag HG10963-ANG
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-OFPSpark® tag HG10963-ACR
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-OFPSpark® tag HG10963-ANR
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10963-NF
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-His tag HG10963-CH
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-His tag HG10963-NH
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-HA tag HG10963-CY
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-HA tag HG10963-NY
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-Myc tag HG10963-CM
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-Myc tag HG10963-NM
Actin-like protein 6A/BAF53a qPCR Primer Pairs, Human HP100838
info info
添加购物车成功! 添加购物车失败!