ACPL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11243-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ACPL2 Reagents
CRO Services
Product recommended

All ACPL2 Reagents
ACPL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1443 bp
Description
Full length Clone DNA of Human acid phosphatase-like 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACPL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
ACPL2 cDNA ORF Clone, Human;FLJ23751 cDNA ORF Clone, Human;UNQ370/PRO706 cDNA ORF Clone, Human
ACPL2 Background Information

acid phosphatase-like protein 2, also known as ACPL2, is a secreted protein which belongs to the histidine acid phosphatase family. A large-scale effort, termed the Secreted Protein Discovery Initiative (SPDI), was undertaken to identify novel secreted and transmembrane proteins. In the first of several approaches, a biological signal sequence trap in yeast cells was utilized to identify cDNA clones encoding putative secreted proteins. A second strategy utilized various algorithms that recognize features such as the hydrophobic properties of signal sequences to identify putative proteins encoded by expressed sequence tags (ESTs) from human cDNA libraries. A third approach surveyed ESTs for protein sequence similarity to a set of known receptors and their ligands with the BLAST algorithm. Finally, both signal-sequence prediction algorithms and BLAST were used to identify single exons of potential genes from within human genomic sequence.

References
  • Clark HF., et al., 2003, Genome Res. 13: 2265-70.
  • Ota T.et al., 2004, Nat. Genet. 36:40-5.
  • ACPL2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ACPL2 cDNA ORF Clone in Cloning Vector, Mouse MG50931-G
    ACPL2 cDNA ORF Clone, Mouse, untagged MG50931-UT
    ACPL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50931-ACG
    ACPL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50931-ACGLN
    ACPL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50931-ACR
    ACPL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50931-CF
    ACPL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50931-NF
    ACPL2 cDNA ORF Clone, Mouse, C-His tag MG50931-CH
    ACPL2 cDNA ORF Clone, Mouse, N-His tag MG50931-NH
    ACPL2 cDNA ORF Clone, Mouse, C-HA tag MG50931-CY
    ACPL2 cDNA ORF Clone, Mouse, N-HA tag MG50931-NY
    ACPL2 cDNA ORF Clone, Mouse, C-Myc tag MG50931-CM
    ACPL2 cDNA ORF Clone, Mouse, N-Myc tag MG50931-NM
    ACPL2 qPCR Primer Pairs, Mouse MP200900

    ACPL2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ACPL2 cDNA ORF Clone in Cloning Vector, Human HG11243-M
    ACPL2 cDNA ORF Clone, Human, untagged HG11243-UT
    ACPL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11243-ACGLN
    ACPL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11243-ACG
    ACPL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11243-ACR
    ACPL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11243-CF
    ACPL2 cDNA ORF Clone, Human, C-His tag HG11243-CH
    ACPL2 cDNA ORF Clone, Human, N-His tag HG11243-NH
    ACPL2 cDNA ORF Clone, Human, C-HA tag HG11243-CY
    ACPL2 cDNA ORF Clone, Human, N-HA tag HG11243-NY
    ACPL2 cDNA ORF Clone, Human, C-Myc tag HG11243-CM
    ACPL2 cDNA ORF Clone, Human, N-Myc tag HG11243-NM
    ACPL2 qPCR Primer Pairs, Human HP101187
    info info
    添加购物车成功! 添加购物车失败!