ACOX2 cDNA ORF Clone, Human, untagged

Cat: HG15207-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACOX2 Reagents
CRO Services
Product recommended

All ACOX2 Reagents
ACOX2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2046 bp
Description
Full length Clone DNA of Human acyl-CoA oxidase 2, branched chain.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACOX2 cDNA ORF Clone, Human, untagged Alternative Names
BCOX cDNA ORF Clone, Human;BRCACOX cDNA ORF Clone, Human;BRCOX cDNA ORF Clone, Human;THCCox cDNA ORF Clone, Human
ACOX2 Background Information
Full Name
acyl-CoA oxidase 2, branched chain

ACOX2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ACOX2 cDNA ORF Clone in Cloning Vector, Mouse MG53775-U
ACOX2 cDNA ORF Clone, Mouse, untagged MG53775-UT
ACOX2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53775-ACGLN
ACOX2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53775-ACG
ACOX2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53775-ANG
ACOX2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53775-ACR
ACOX2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53775-ANR
ACOX2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53775-CF
ACOX2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53775-NF
ACOX2 cDNA ORF Clone, Mouse, C-His tag MG53775-CH
ACOX2 cDNA ORF Clone, Mouse, N-His tag MG53775-NH
ACOX2 cDNA ORF Clone, Mouse, C-HA tag MG53775-CY
ACOX2 cDNA ORF Clone, Mouse, N-HA tag MG53775-NY
ACOX2 cDNA ORF Clone, Mouse, C-Myc tag MG53775-CM
ACOX2 cDNA ORF Clone, Mouse, N-Myc tag MG53775-NM

ACOX2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ACOX2 cDNA ORF Clone in Cloning Vector, Human HG15207-G
ACOX2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15207-ACGLN
ACOX2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15207-ACG
ACOX2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15207-ANG
ACOX2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15207-ACR
ACOX2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15207-ANR
ACOX2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15207-CF
ACOX2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15207-NF
ACOX2 cDNA ORF Clone, Human, C-His tag HG15207-CH
ACOX2 cDNA ORF Clone, Human, N-His tag HG15207-NH
ACOX2 cDNA ORF Clone, Human, C-HA tag HG15207-CY
ACOX2 cDNA ORF Clone, Human, N-HA tag HG15207-NY
ACOX2 cDNA ORF Clone, Human, C-Myc tag HG15207-CM
ACOX2 cDNA ORF Clone, Human, N-Myc tag HG15207-NM
ACOX2 qPCR Primer Pairs, Human HP103833
info info
添加购物车成功! 添加购物车失败!