HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-HA tag

Cat: VG40246-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HIV Tat protein Reagents
CRO Services
Product recommended

All HIV Tat protein Reagents
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-HA tag General Information
Gene
Species
HIV
NCBI Ref Seq
RefSeq ORF Size
261 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) tat with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HIV Tat protein Background Information
Full Name
HIV-1 Tat specific factor 1

HIV Tat protein cDNA ORF Clone, HIV, Related Products

Product Name Catalog#(PDF)
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid (Codon Optimized) VG40246-G
HIV-1 (group M, subtype B, strain HXB2) tat natural ORF mammalian expression plasmid VG40246-UT
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-GFPSpark tag VG40246-ACG
HIV-1 (group M, subtype B, strain HXB2) tat Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40246-ACGLN
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-GFPSpark tag VG40246-ANG
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40246-ACR
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40246-ANR
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-Flag tag VG40246-CF
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-Flag tag VG40246-NF
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-His tag VG40246-CH
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-His tag VG40246-NH
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-HA tag VG40246-NY
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-Myc tag VG40246-CM
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-Myc tag VG40246-NM
info info
添加购物车成功! 添加购物车失败!