HHIP cDNA ORF Clone, Human, C-His tag

Cat: HG13798-G-H
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HHIP Reagents
CRO Services

All HHIP Reagents
HHIP cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2103 bp
Sequence Description
Identical with the Gene Bank Ref.ID sequence.
Description
Full length Clone DNA of Human hedgehog interacting protein with His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-His
Restriction Sites
KpnI + XhoI (5.5kb + 2.13kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
HHIP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HHIP cDNA ORF Clone, Human, C-His tag Validated Images
Human HHIP Gene Plasmid Map 7528
HHIP cDNA ORF Clone, Human, C-His tag Alternative Names
HIP cDNA ORF Clone, Human
HHIP Background Information
Full Name
hedgehog interacting protein

HHIP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HHIP cDNA ORF Clone in Cloning Vector, Mouse MG50380-M
HHIP cDNA ORF Clone, Mouse, untagged MG50380-UT
HHIP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50380-ACGLN
HHIP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50380-ACG
HHIP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50380-ACR
HHIP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50380-CF
HHIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50380-NF
HHIP cDNA ORF Clone, Mouse, C-His tag MG50380-CH
HHIP cDNA ORF Clone, Mouse, N-His tag MG50380-NH
HHIP cDNA ORF Clone, Mouse, C-HA tag MG50380-CY
HHIP cDNA ORF Clone, Mouse, N-HA tag MG50380-NY
HHIP cDNA ORF Clone, Mouse, C-Myc tag MG50380-CM
HHIP cDNA ORF Clone, Mouse, N-Myc tag MG50380-NM
HHIP qPCR Primer Pairs, Mouse MP200400

HHIP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HHIP cDNA ORF Clone in Cloning Vector, Human HG13798-G
HHIP cDNA ORF Clone, Human, untagged HG13798-UT
HHIP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13798-ACGLN
HHIP cDNA ORF Clone, Human, C-GFPSpark® tag HG13798-ACG
HHIP cDNA ORF Clone, Human, C-OFPSpark® tag HG13798-ACR
HHIP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13798-CF
HHIP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13798-NF
HHIP cDNA ORF Clone, Human, C-His tag HG13798-CH
HHIP cDNA ORF Clone, Human, N-His tag HG13798-NH
HHIP cDNA ORF Clone, Human, C-HA tag HG13798-CY
HHIP cDNA ORF Clone, Human, N-HA tag HG13798-NY
HHIP cDNA ORF Clone, Human, C-Myc tag HG13798-CM
HHIP cDNA ORF Clone, Human, N-Myc tag HG13798-NM
HHIP qPCR Primer Pairs, Human HP102471
info info
添加购物车成功! 添加购物车失败!