GMF beta cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13244-G-F
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GMF beta Reagents
CRO Services
Product recommended

All GMF beta Reagents
GMF beta cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
465 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glia maturation factor, beta with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 0.5kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
GMF beta cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GMF beta cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human G-CSF/CSF3 Gene Plasmid Map 7153
GMF beta cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
GMF cDNA ORF Clone, Human
GMF beta Background Information

GMFB is a nerve growth factor which belongs to the actin-binding proteins ADF family, GMF subfamily. GMFB is involved in nervous system development, angiogenesis and immune function. It is especially crucial for the nervous system. GMFB causes brain cell differentiation, stimulates neural regeneration and inhibits tumor cell proliferation. It contains 1 ADF-H domain and is phosphorylated after phorbol ester stimulation. GMFB overexpression in astrocytes results in the increase of BDNF production. GMFB expression is increased by exercise, thus BDNF is important for exercise-induction of BDNF.

Full Name
glia maturation factor, beta
References
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Zaheer S, et al. (2011) Augmented expression of glia maturation factor in Alzheimer's disease. Neuroscience. 194:227-33.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • GMF beta cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GMF beta cDNA ORF Clone in Cloning Vector, Rat RG86354-U
    GMF beta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86354-ACGLN

    GMF beta cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GMF beta cDNA ORF Clone in Cloning Vector, Mouse MG59976-U
    GMF beta cDNA ORF Clone, Mouse, untagged MG59976-UT
    GMF beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59976-ACGLN
    GMF beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59976-ACG
    GMF beta cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59976-ANG
    GMF beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59976-ACR
    GMF beta cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59976-ANR
    GMF beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59976-CF
    GMF beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59976-NF
    GMF beta cDNA ORF Clone, Mouse, C-His tag MG59976-CH
    GMF beta cDNA ORF Clone, Mouse, N-His tag MG59976-NH
    GMF beta cDNA ORF Clone, Mouse, C-HA tag MG59976-CY
    GMF beta cDNA ORF Clone, Mouse, N-HA tag MG59976-NY
    GMF beta cDNA ORF Clone, Mouse, C-Myc tag MG59976-CM
    GMF beta cDNA ORF Clone, Mouse, N-Myc tag MG59976-NM

    GMF beta cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GMF beta cDNA ORF Clone in Cloning Vector, Human HG13244-G
    GMF beta cDNA ORF Clone, Human, untagged HG13244-UT
    GMF beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13244-ACGLN
    GMF beta cDNA ORF Clone, Human, C-GFPSpark® tag HG13244-ACG
    GMF beta cDNA ORF Clone, Human, C-OFPSpark® tag HG13244-ACR
    GMF beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13244-CF
    GMF beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13244-NF
    GMF beta cDNA ORF Clone, Human, C-His tag HG13244-CH
    GMF beta cDNA ORF Clone, Human, N-His tag HG13244-NH
    GMF beta cDNA ORF Clone, Human, C-HA tag HG13244-CY
    GMF beta cDNA ORF Clone, Human, N-HA tag HG13244-NY
    GMF beta cDNA ORF Clone, Human, C-Myc tag HG13244-CM
    GMF beta cDNA ORF Clone, Human, N-Myc tag HG13244-NM
    GMF beta qPCR Primer Pairs, Human HP101955
    info info
    添加购物车成功! 添加购物车失败!