C1 inhibitor cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60083-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All C1 inhibitor Reagents
CRO Services
Product recommended

All C1 inhibitor Reagents
C1 inhibitor cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1440 bp
Description
Full length Clone DNA of Ferret serpin peptidase inhibitor, clade G (C1 inhibitor), member 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C1 inhibitor Background Information

Plasma protease C1 inhibitor, also known as C1-inhibiting factor, C1-INH, C1 esterase inhibitor, SERPING1 and C1IN, is a serine proteinase inhibitor (serpin) that regulates activation of both the complement and contact systems. By its C-terminal part (serpin domain), characterized by three beta-sheets and an exposed mobile reactive loop, C1-INH binds, and blocks the activity of its target proteases. The N-terminal end (nonserpin domain) confers to C1-INH the capacity to bind lipopolysaccharides and E-selectin. Owing to this moiety, C1-INH intervenes in regulation of the inflammatory reaction. The heterozygous deficiency of C1-INH results in hereditary angioedema (HAE). Owing to its ability to modulate the contact and complement systems and the convincing safety profile, plasma-derived C1 inhibitor is an attractive therapeutic protein to treat inflammatory diseases other than HAE. Deficiency of C1 inhibitor results in hereditary angioedema, which is characterized by recurrent episodes of localized angioedema of the skin, gastrointestinal mucosa or upper respiratory mucosa. C1 inhibitor may prove useful in a variety of other diseases including septic shock, reperfusion injury, hyperacute transplant rejection, traumatic and hemorrhagic shock, and the increased vascular permeability associated with thermal injury, interleukin-2 therapy and cardiopulmonary bypass.

Full Name
serpin peptidase inhibitor, clade G (C1 inhibitor), member 1
References
  • Davis AE 3rd. et al. (2004) Biological effects of C1 inhibitor. Drug News Perspect. 17(7): 439-46.
  • Cicardi M, et al. (2005) C1 inhibitor: molecular and clinical aspects. Springer Semin Immunopathol. 27(3): 286-98.
  • Wouters D, et al. (2008) C1 inhibitor: just a serine protease inhibitor? New and old considerations on therapeutic applications of C1 inhibitor. Expert Opin Biol Ther. 8(8): 1225-40.
  • Cugno M, et al. (2009) C1-inhibitor deficiency and angioedema: molecular mechanisms and clinical progress. Trends Mol Med. 15(2): 69-78.
  • C1 inhibitor cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    C1 inhibitor cDNA ORF Clone in Cloning Vector, Ferret FG60083-G
    C1 inhibitor cDNA ORF Clone, Ferret, untagged FG60083-UT
    C1 inhibitor Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60083-ACGLN
    C1 inhibitor cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60083-ACG
    C1 inhibitor cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60083-ACR
    C1 inhibitor cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60083-CF
    C1 inhibitor cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60083-NF
    C1 inhibitor cDNA ORF Clone, Ferret, C-His tag FG60083-CH
    C1 inhibitor cDNA ORF Clone, Ferret, N-His tag FG60083-NH
    C1 inhibitor cDNA ORF Clone, Ferret, C-HA tag FG60083-CY
    C1 inhibitor cDNA ORF Clone, Ferret, N-HA tag FG60083-NY
    C1 inhibitor cDNA ORF Clone, Ferret, N-Myc tag FG60083-NM

    C1 inhibitor cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    C1 inhibitor cDNA ORF Clone in Cloning Vector, Rat RG81647-G
    C1 inhibitor cDNA ORF Clone, Rat, untagged RG81647-UT
    C1 inhibitor Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81647-ACGLN
    C1 inhibitor cDNA ORF Clone, Rat, C-GFPSpark® tag RG81647-ACG
    C1 inhibitor cDNA ORF Clone, Rat, C-OFPSpark® tag RG81647-ACR
    C1 inhibitor cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81647-CF
    C1 inhibitor cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81647-NF
    C1 inhibitor cDNA ORF Clone, Rat, C-His tag RG81647-CH
    C1 inhibitor cDNA ORF Clone, Rat, N-His tag RG81647-NH
    C1 inhibitor cDNA ORF Clone, Rat, C-HA tag RG81647-CY
    C1 inhibitor cDNA ORF Clone, Rat, N-HA tag RG81647-NY
    C1 inhibitor cDNA ORF Clone, Rat, C-Myc tag RG81647-CM
    C1 inhibitor cDNA ORF Clone, Rat, N-Myc tag RG81647-NM

    C1 inhibitor cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    C1 inhibitor cDNA ORF Clone in Cloning Vector, Mouse MG53641-U
    C1 inhibitor cDNA ORF Clone, Mouse, untagged MG53641-UT
    C1 inhibitor cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53641-ACG
    C1 inhibitor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53641-ACGLN
    C1 inhibitor cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53641-ACR
    C1 inhibitor cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53641-CF
    C1 inhibitor cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53641-NF
    C1 inhibitor cDNA ORF Clone, Mouse, C-His tag MG53641-CH
    C1 inhibitor cDNA ORF Clone, Mouse, N-His tag MG53641-NH
    C1 inhibitor cDNA ORF Clone, Mouse, C-HA tag MG53641-CY
    C1 inhibitor cDNA ORF Clone, Mouse, N-HA tag MG53641-NY
    C1 inhibitor cDNA ORF Clone, Mouse, C-Myc tag MG53641-CM
    C1 inhibitor cDNA ORF Clone, Mouse, N-Myc tag MG53641-NM

    C1 inhibitor cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    C1 inhibitor cDNA ORF Clone in Cloning Vector, Human HG10995-U
    C1 inhibitor cDNA ORF Clone, Human, untagged HG10995-UT
    C1 inhibitor Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10995-ACGLN
    C1 inhibitor cDNA ORF Clone, Human, C-GFPSpark® tag HG10995-ACG
    C1 inhibitor cDNA ORF Clone, Human, C-OFPSpark® tag HG10995-ACR
    C1 inhibitor cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10995-CF
    C1 inhibitor cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10995-NF
    C1 inhibitor cDNA ORF Clone, Human, C-His tag HG10995-CH
    C1 inhibitor cDNA ORF Clone, Human, N-His tag HG10995-NH
    C1 inhibitor cDNA ORF Clone, Human, C-HA tag HG10995-CY
    C1 inhibitor cDNA ORF Clone, Human, N-HA tag HG10995-NY
    C1 inhibitor cDNA ORF Clone, Human, C-Myc tag HG10995-CM
    C1 inhibitor cDNA ORF Clone, Human, N-Myc tag HG10995-NM
    C1 inhibitor qPCR Primer Pairs, Human HP100957
    info info
    添加购物车成功! 添加购物车失败!