RPL9 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag

Cat: FG60093-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPL9 Reagents
CRO Services
Product recommended

All RPL9 Reagents
RPL9 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
579 bp
Description
Full length Clone DNA of Ferret ribosomal protein L9 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL9 Background Information
Full Name
ribosomal protein L9

RPL9 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
RPL9 cDNA ORF Clone in Cloning Vector, Ferret FG60093-G
RPL9 cDNA ORF Clone, Ferret, untagged FG60093-UT
RPL9 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60093-ACGLN
RPL9 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60093-ACG
RPL9 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60093-ANG
RPL9 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60093-ACR
RPL9 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60093-ANR
RPL9 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60093-CF
RPL9 cDNA ORF Clone, Ferret, C-His tag FG60093-CH
RPL9 cDNA ORF Clone, Ferret, N-His tag FG60093-NH
RPL9 cDNA ORF Clone, Ferret, C-HA tag FG60093-CY
RPL9 cDNA ORF Clone, Ferret, N-HA tag FG60093-NY
RPL9 cDNA ORF Clone, Ferret, C-Myc tag FG60093-CM
RPL9 cDNA ORF Clone, Ferret, N-Myc tag FG60093-NM

RPL9 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
RPL9 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90570-G
RPL9 cDNA ORF Clone, Cynomolgus, untagged CG90570-UT
RPL9 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90570-ACGLN
RPL9 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90570-ACG
RPL9 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90570-ANG
RPL9 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90570-ACR
RPL9 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90570-ANR
RPL9 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90570-CF
RPL9 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90570-NF
RPL9 cDNA ORF Clone, Cynomolgus, C-His tag CG90570-CH
RPL9 cDNA ORF Clone, Cynomolgus, N-His tag CG90570-NH
RPL9 cDNA ORF Clone, Cynomolgus, C-HA tag CG90570-CY
RPL9 cDNA ORF Clone, Cynomolgus, N-HA tag CG90570-NY
RPL9 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90570-CM
RPL9 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90570-NM

RPL9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL9 cDNA ORF Clone in Cloning Vector, Mouse MG52365-U
RPL9 cDNA ORF Clone, Mouse, untagged MG52365-UT
RPL9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52365-ACGLN
RPL9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52365-ACG
RPL9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52365-ANG
RPL9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52365-ACR
RPL9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52365-ANR
RPL9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52365-CF
RPL9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52365-NF
RPL9 cDNA ORF Clone, Mouse, C-His tag MG52365-CH
RPL9 cDNA ORF Clone, Mouse, N-His tag MG52365-NH
RPL9 cDNA ORF Clone, Mouse, C-HA tag MG52365-CY
RPL9 cDNA ORF Clone, Mouse, N-HA tag MG52365-NY
RPL9 cDNA ORF Clone, Mouse, C-Myc tag MG52365-CM
RPL9 cDNA ORF Clone, Mouse, N-Myc tag MG52365-NM
RPL9 qPCR Primer Pairs, Mouse MP202238

RPL9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL9 cDNA ORF Clone in Cloning Vector, Human HG16984-U
RPL9 cDNA ORF Clone, Human, untagged HG16984-UT
RPL9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16984-ACGLN
RPL9 cDNA ORF Clone, Human, C-GFPSpark® tag HG16984-ACG
RPL9 cDNA ORF Clone, Human, N-GFPSpark® tag HG16984-ANG
RPL9 cDNA ORF Clone, Human, C-OFPSpark® tag HG16984-ACR
RPL9 cDNA ORF Clone, Human, N-OFPSpark® tag HG16984-ANR
RPL9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16984-CF
RPL9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16984-NF
RPL9 cDNA ORF Clone, Human, C-His tag HG16984-CH
RPL9 cDNA ORF Clone, Human, N-His tag HG16984-NH
RPL9 cDNA ORF Clone, Human, C-HA tag HG16984-CY
RPL9 cDNA ORF Clone, Human, N-HA tag HG16984-NY
RPL9 cDNA ORF Clone, Human, C-Myc tag HG16984-CM
RPL9 cDNA ORF Clone, Human, N-Myc tag HG16984-NM
info info
添加购物车成功! 添加购物车失败!