RPL6 cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60065-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPL6 Reagents
CRO Services
Product recommended

All RPL6 Reagents
RPL6 cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
867 bp
Description
Full length Clone DNA of Ferret ribosomal protein L6 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL6 Background Information
Full Name
ribosomal protein L6

RPL6 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
RPL6 cDNA ORF Clone in Cloning Vector, Ferret FG60065-G
RPL6 cDNA ORF Clone, Ferret, untagged FG60065-UT
RPL6 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60065-ACG
RPL6 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60065-ACGLN
RPL6 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60065-ANG
RPL6 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60065-ACR
RPL6 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60065-ANR
RPL6 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60065-CF
RPL6 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60065-NF
RPL6 cDNA ORF Clone, Ferret, C-His tag FG60065-CH
RPL6 cDNA ORF Clone, Ferret, N-His tag FG60065-NH
RPL6 cDNA ORF Clone, Ferret, C-HA tag FG60065-CY
RPL6 cDNA ORF Clone, Ferret, N-HA tag FG60065-NY
RPL6 cDNA ORF Clone, Ferret, N-Myc tag FG60065-NM

RPL6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPL6 cDNA ORF Clone in Cloning Vector, Rat RG85425-U

RPL6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL6 cDNA ORF Clone in Cloning Vector, Mouse MG51241-U
RPL6 cDNA ORF Clone, Mouse, untagged MG51241-UT
RPL6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51241-ACG
RPL6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51241-ACGLN
RPL6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51241-ANG
RPL6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51241-ACR
RPL6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51241-ANR
RPL6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51241-CF
RPL6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51241-NF
RPL6 cDNA ORF Clone, Mouse, C-His tag MG51241-CH
RPL6 cDNA ORF Clone, Mouse, N-His tag MG51241-NH
RPL6 cDNA ORF Clone, Mouse, C-HA tag MG51241-CY
RPL6 cDNA ORF Clone, Mouse, N-HA tag MG51241-NY
RPL6 cDNA ORF Clone, Mouse, C-Myc tag MG51241-CM
RPL6 cDNA ORF Clone, Mouse, N-Myc tag MG51241-NM
RPL6 qPCR Primer Pairs, Mouse MP201124

RPL6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL6 cDNA ORF Clone in Cloning Vector, Human HG17086-U
RPL6 cDNA ORF Clone, Human, untagged HG17086-UT
RPL6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17086-ACGLN
RPL6 cDNA ORF Clone, Human, C-GFPSpark® tag HG17086-ACG
RPL6 cDNA ORF Clone, Human, N-GFPSpark® tag HG17086-ANG
RPL6 cDNA ORF Clone, Human, C-OFPSpark® tag HG17086-ACR
RPL6 cDNA ORF Clone, Human, N-OFPSpark® tag HG17086-ANR
RPL6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17086-CF
RPL6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17086-NF
RPL6 cDNA ORF Clone, Human, C-His tag HG17086-CH
RPL6 cDNA ORF Clone, Human, N-His tag HG17086-NH
RPL6 cDNA ORF Clone, Human, C-HA tag HG17086-CY
RPL6 cDNA ORF Clone, Human, N-HA tag HG17086-NY
RPL6 cDNA ORF Clone, Human, C-Myc tag HG17086-CM
RPL6 cDNA ORF Clone, Human, N-Myc tag HG17086-NM
info info
添加购物车成功! 添加购物车失败!