PRDX3 cDNA ORF Clone,Ferret

All PRDX3 Reagents

PRDX3 cDNA ORF Clone, Ferret, C-Myc tag General Information

Gene

Species

Ferret

NCBI Ref Seq

XM_004795126.1

RefSeq ORF Size

774 bp

Description

Full length Clone DNA of Ferret peroxiredoxin 3 with C terminal Myc tag.

Plasmid

Promoter

Enhanced CMV promoter

Vector

pCMV3-C-Myc

Tag Sequence

Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )

Quality Control

The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRDX3 Background Information

Full Name

peroxiredoxin 3

Research Areas

PRDX3 cDNA ORF Clone, Canine, Related Products

Product Name	Catalog#(PDF)
PRDX3 cDNA ORF Clone in Cloning Vector, Canine	DG70217-U
PRDX3 cDNA ORF Clone, Canine, untagged	DG70217-UT
PRDX3 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag	DG70217-ACGLN
PRDX3 cDNA ORF Clone, Canine, C-GFPSpark® tag	DG70217-ACG
PRDX3 cDNA ORF Clone, Canine, N-GFPSpark® tag	DG70217-ANG
PRDX3 cDNA ORF Clone, Canine, C-OFPSpark® tag	DG70217-ACR
PRDX3 cDNA ORF Clone, Canine, N-OFPSpark® tag	DG70217-ANR
PRDX3 cDNA ORF Clone, Canine, C-DDK (Flag®) tag	DG70217-CF
PRDX3 cDNA ORF Clone, Canine, N-DDK (Flag®) tag	DG70217-NF
PRDX3 cDNA ORF Clone, Canine, C-His tag	DG70217-CH
PRDX3 cDNA ORF Clone, Canine, N-His tag	DG70217-NH
PRDX3 cDNA ORF Clone, Canine, C-HA tag	DG70217-CY
PRDX3 cDNA ORF Clone, Canine, N-HA tag	DG70217-NY
PRDX3 cDNA ORF Clone, Canine, C-Myc tag	DG70217-CM
PRDX3 cDNA ORF Clone, Canine, N-Myc tag	DG70217-NM

PRDX3 cDNA ORF Clone, Ferret, Related Products

Product Name	Catalog#(PDF)
PRDX3 cDNA ORF Clone in Cloning Vector, Ferret	FG60068-G
PRDX3 cDNA ORF Clone, Ferret, untagged	FG60068-UT
PRDX3 cDNA ORF Clone, Ferret, C-GFPSpark® tag	FG60068-ACG
PRDX3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag	FG60068-ACGLN
PRDX3 cDNA ORF Clone, Ferret, N-GFPSpark® tag	FG60068-ANG
PRDX3 cDNA ORF Clone, Ferret, C-OFPSpark® tag	FG60068-ACR
PRDX3 cDNA ORF Clone, Ferret, N-OFPSpark® tag	FG60068-ANR
PRDX3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag	FG60068-CF
PRDX3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag	FG60068-NF
PRDX3 cDNA ORF Clone, Ferret, C-His tag	FG60068-CH
PRDX3 cDNA ORF Clone, Ferret, N-His tag	FG60068-NH
PRDX3 cDNA ORF Clone, Ferret, C-HA tag	FG60068-CY
PRDX3 cDNA ORF Clone, Ferret, N-HA tag	FG60068-NY
PRDX3 cDNA ORF Clone, Ferret, N-Myc tag	FG60068-NM

PRDX3 cDNA ORF Clone, Rat, Related Products

Product Name	Catalog#(PDF)
PRDX3 cDNA ORF Clone in Cloning Vector, Rat	RG81103-U
PRDX3 cDNA ORF Clone, Rat, untagged	RG81103-UT
PRDX3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag	RG81103-ACGLN
PRDX3 cDNA ORF Clone, Rat, C-GFPSpark® tag	RG81103-ACG
PRDX3 cDNA ORF Clone, Rat, N-GFPSpark® tag	RG81103-ANG
PRDX3 cDNA ORF Clone, Rat, C-OFPSpark® tag	RG81103-ACR
PRDX3 cDNA ORF Clone, Rat, N-OFPSpark® tag	RG81103-ANR
PRDX3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag	RG81103-CF
PRDX3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag	RG81103-NF
PRDX3 cDNA ORF Clone, Rat, C-His tag	RG81103-CH
PRDX3 cDNA ORF Clone, Rat, N-His tag	RG81103-NH
PRDX3 cDNA ORF Clone, Rat, C-HA tag	RG81103-CY
PRDX3 cDNA ORF Clone, Rat, N-HA tag	RG81103-NY
PRDX3 cDNA ORF Clone, Rat, C-Myc tag	RG81103-CM
PRDX3 cDNA ORF Clone, Rat, N-Myc tag	RG81103-NM
PRDX3 qPCR Primer Pairs, Rat	RP301060

PRDX3 cDNA ORF Clone, Mouse, Related Products

Product Name	Catalog#(PDF)
PRDX3 cDNA ORF Clone in Cloning Vector, Mouse	MG52588-G
PRDX3 cDNA ORF Clone, Mouse, untagged	MG52588-UT
PRDX3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag	MG52588-ACGLN
PRDX3 cDNA ORF Clone, Mouse, C-GFPSpark® tag	MG52588-ACG
PRDX3 cDNA ORF Clone, Mouse, N-GFPSpark® tag	MG52588-ANG
PRDX3 cDNA ORF Clone, Mouse, C-OFPSpark® tag	MG52588-ACR
PRDX3 cDNA ORF Clone, Mouse, N-OFPSpark® tag	MG52588-ANR
PRDX3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag	MG52588-CF
PRDX3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag	MG52588-NF
PRDX3 cDNA ORF Clone, Mouse, C-His tag	MG52588-CH
PRDX3 cDNA ORF Clone, Mouse, N-His tag	MG52588-NH
PRDX3 cDNA ORF Clone, Mouse, C-HA tag	MG52588-CY
PRDX3 cDNA ORF Clone, Mouse, N-HA tag	MG52588-NY
PRDX3 cDNA ORF Clone, Mouse, C-Myc tag	MG52588-CM
PRDX3 cDNA ORF Clone, Mouse, N-Myc tag	MG52588-NM
PRDX3 qPCR Primer Pairs, Mouse	MP202459

PRDX3 cDNA ORF Clone, Human, Related Products

Product Name	Catalog#(PDF)
PRDX3 cDNA ORF Clone in Cloning Vector, Human	HG11256-M
PRDX3 cDNA ORF Clone, Human, untagged	HG11256-UT
PRDX3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag	HG11256-ACGLN
PRDX3 cDNA ORF Clone, Human, C-GFPSpark® tag	HG11256-ACG
PRDX3 cDNA ORF Clone, Human, N-GFPSpark® tag	HG11256-ANG
PRDX3 cDNA ORF Clone, Human, C-OFPSpark® tag	HG11256-ACR
PRDX3 cDNA ORF Clone, Human, N-OFPSpark® tag	HG11256-ANR
PRDX3 cDNA ORF Clone, Human, C-DDK (Flag®) tag	HG11256-CF
PRDX3 cDNA ORF Clone, Human, N-DDK (Flag®) tag	HG11256-NF
PRDX3 cDNA ORF Clone, Human, C-His tag	HG11256-CH
PRDX3 cDNA ORF Clone, Human, N-His tag	HG11256-NH
PRDX3 cDNA ORF Clone, Human, C-HA tag	HG11256-CY
PRDX3 cDNA ORF Clone, Human, N-HA tag	HG11256-NY
PRDX3 cDNA ORF Clone, Human, C-Myc tag	HG11256-CM
PRDX3 cDNA ORF Clone, Human, N-Myc tag	HG11256-NM
PRDX3 qPCR Primer Pairs, Human	HP101140

Documents
Datasheet Download
MSDS Download
Protocol Download
You Recently Viewed