MRPL39 cDNA ORF Clone, Ferret, C-HA tag

Cat: FG60159-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MRPL39 Reagents
CRO Services
Product recommended

All MRPL39 Reagents
MRPL39 cDNA ORF Clone, Ferret, C-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Description
Full length Clone DNA of Ferret mitochondrial ribosomal protein L39 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPL39 Background Information
Full Name
mitochondrial ribosomal protein L39

MRPL39 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
MRPL39 cDNA ORF Clone in Cloning Vector, Ferret FG60159-G
MRPL39 cDNA ORF Clone, Ferret, untagged FG60159-UT
MRPL39 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60159-ACG
MRPL39 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60159-ACGLN
MRPL39 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60159-ANG
MRPL39 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60159-ACR
MRPL39 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60159-ANR
MRPL39 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60159-CF
MRPL39 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60159-NF
MRPL39 cDNA ORF Clone, Ferret, C-His tag FG60159-CH
MRPL39 cDNA ORF Clone, Ferret, N-His tag FG60159-NH
MRPL39 cDNA ORF Clone, Ferret, N-HA tag FG60159-NY
MRPL39 cDNA ORF Clone, Ferret, C-Myc tag FG60159-CM
MRPL39 cDNA ORF Clone, Ferret, N-Myc tag FG60159-NM

MRPL39 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPL39 cDNA ORF Clone in Cloning Vector, Mouse MG5A5295-U
MRPL39 cDNA ORF Clone, Mouse, untagged MG5A5295-UT
MRPL39 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5295-ACG
MRPL39 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5295-ACGLN
MRPL39 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5295-ANG
MRPL39 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5295-ACR
MRPL39 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5295-ANR
MRPL39 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5295-CF
MRPL39 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5295-NF
MRPL39 cDNA ORF Clone, Mouse, C-His tag MG5A5295-CH
MRPL39 cDNA ORF Clone, Mouse, N-His tag MG5A5295-NH
MRPL39 cDNA ORF Clone, Mouse, C-HA tag MG5A5295-CY
MRPL39 cDNA ORF Clone, Mouse, N-HA tag MG5A5295-NY
MRPL39 cDNA ORF Clone, Mouse, C-Myc tag MG5A5295-CM
MRPL39 cDNA ORF Clone, Mouse, N-Myc tag MG5A5295-NM
info info
添加购物车成功! 添加购物车失败!