METTL7A cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60050-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All METTL7A Reagents
CRO Services
Product recommended

All METTL7A Reagents
METTL7A cDNA ORF Clone, Ferret, N-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
735 bp
Description
Full length Clone DNA of Ferret methyltransferase like 7A with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

METTL7A Background Information
Full Name
methyltransferase like 7A

METTL7A cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
METTL7A cDNA ORF Clone in Cloning Vector, Ferret FG60050-G
METTL7A cDNA ORF Clone, Ferret, untagged FG60050-UT
METTL7A cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60050-ACG
METTL7A Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60050-ACGLN
METTL7A cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60050-ACR
METTL7A cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60050-CF
METTL7A cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60050-NF
METTL7A cDNA ORF Clone, Ferret, C-His tag FG60050-CH
METTL7A cDNA ORF Clone, Ferret, N-His tag FG60050-NH
METTL7A cDNA ORF Clone, Ferret, C-HA tag FG60050-CY
METTL7A cDNA ORF Clone, Ferret, C-Myc tag FG60050-CM
METTL7A cDNA ORF Clone, Ferret, N-Myc tag FG60050-NM

METTL7A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
METTL7A cDNA ORF Clone in Cloning Vector, Human HG12361-U
METTL7A cDNA ORF Clone, Human, untagged HG12361-UT
METTL7A cDNA ORF Clone, Human, C-GFPSpark® tag HG12361-ACG
METTL7A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12361-ACGLN
METTL7A cDNA ORF Clone, Human, N-GFPSpark® tag HG12361-ANG
METTL7A cDNA ORF Clone, Human, C-OFPSpark® tag HG12361-ACR
METTL7A cDNA ORF Clone, Human, N-OFPSpark® tag HG12361-ANR
METTL7A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12361-CF
METTL7A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12361-NF
METTL7A cDNA ORF Clone, Human, C-His tag HG12361-CH
METTL7A cDNA ORF Clone, Human, N-His tag HG12361-NH
METTL7A cDNA ORF Clone, Human, C-HA tag HG12361-CY
METTL7A cDNA ORF Clone, Human, N-HA tag HG12361-NY
METTL7A cDNA ORF Clone, Human, C-Myc tag HG12361-CM
METTL7A cDNA ORF Clone, Human, N-Myc tag HG12361-NM
METTL7A qPCR Primer Pairs, Human HP104726
info info
添加购物车成功! 添加购物车失败!