CD177 cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60079-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD177 Reagents
CRO Services
Product recommended

All CD177 Reagents
CD177 cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1329 bp
Description
Full length Clone DNA of Ferret CD177 antigen-like with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD177 Background Information
Full Name
CD177 molecule

CD177 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
CD177 cDNA ORF Clone in Cloning Vector, Ferret FG60079-G
CD177 cDNA ORF Clone, Ferret, untagged FG60079-UT
CD177 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60079-ACG
CD177 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60079-ACR
CD177 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60079-CF
CD177 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60079-NF
CD177 cDNA ORF Clone, Ferret, C-His tag FG60079-CH
CD177 cDNA ORF Clone, Ferret, N-His tag FG60079-NH
CD177 cDNA ORF Clone, Ferret, C-HA tag FG60079-CY
CD177 cDNA ORF Clone, Ferret, N-HA tag FG60079-NY
CD177 cDNA ORF Clone, Ferret, N-Myc tag FG60079-NM

CD177 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD177 cDNA ORF Clone in Cloning Vector, Mouse MG54630-U
CD177 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54630-ACGLN

CD177 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD177 cDNA ORF Clone in Cloning Vector, Human HG14501-G
CD177 cDNA ORF Clone, Human, untagged HG14501-UT
CD177 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14501-ACGLN
CD177 cDNA ORF Clone, Human, C-GFPSpark® tag HG14501-ACG
CD177 cDNA ORF Clone, Human, C-OFPSpark® tag HG14501-ACR
CD177 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14501-CF
CD177 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14501-NF
CD177 cDNA ORF Clone, Human, C-His tag HG14501-CH
CD177 cDNA ORF Clone, Human, N-His tag HG14501-NH
CD177 cDNA ORF Clone, Human, C-HA tag HG14501-CY
CD177 cDNA ORF Clone, Human, N-HA tag HG14501-NY
CD177 cDNA ORF Clone, Human, C-Myc tag HG14501-CM
CD177 cDNA ORF Clone, Human, N-Myc tag HG14501-NM
CD177 qPCR Primer Pairs, Human HP103148
info info
添加购物车成功! 添加购物车失败!