CD14 cDNA ORF Clone, Ferret, C-HA tag

Cat: FG60047-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD14 Reagents
CRO Services
Product recommended

All CD14 Reagents
CD14 cDNA ORF Clone, Ferret, C-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1116 bp
Description
Full length Clone DNA of Ferret CD14 molecule with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD14 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 14 (CD14) is a member of the CD system. It takes its name from its inclusion in the CD molecule surface marker proteins. CD14 exists in two forms: a form anchored into the membrane or a soluble form. CD14 was found expressed in macrophages, neutrophil granulocyte and dendritic cells. The major function is serve as a co-receptor (along with TLR4 and MD-2) for the bacterial lipopolysaccharide (LPS) and other pathogen-associated molecular patterns.

Full Name
CD14 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • SD Wright, et al. (1990) CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science. 249 (4975): 1431-3.
  • CD14 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    CD14 cDNA ORF Clone in Cloning Vector, Ferret FG60047-G
    CD14 cDNA ORF Clone, Ferret, untagged FG60047-UT
    CD14 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60047-ACGLN
    CD14 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60047-ACG
    CD14 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60047-ACR
    CD14 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60047-CF
    CD14 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60047-NF
    CD14 cDNA ORF Clone, Ferret, C-His tag FG60047-CH
    CD14 cDNA ORF Clone, Ferret, N-His tag FG60047-NH
    CD14 cDNA ORF Clone, Ferret, N-HA tag FG60047-NY
    CD14 cDNA ORF Clone, Ferret, C-Myc tag FG60047-CM
    CD14 cDNA ORF Clone, Ferret, N-Myc tag FG60047-NM

    CD14 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD14 cDNA ORF Clone in Cloning Vector, Rhesus CG90174-G
    CD14 cDNA ORF Clone, Rhesus, untagged CG90174-UT
    CD14 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90174-ACGLN
    CD14 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90174-ACG
    CD14 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90174-ACR
    CD14 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90174-CF
    CD14 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90174-NF
    CD14 cDNA ORF Clone, Rhesus, C-His tag CG90174-CH
    CD14 cDNA ORF Clone, Rhesus, N-His tag CG90174-NH
    CD14 cDNA ORF Clone, Rhesus, C-HA tag CG90174-CY
    CD14 cDNA ORF Clone, Rhesus, N-HA tag CG90174-NY
    CD14 cDNA ORF Clone, Rhesus, C-Myc tag CG90174-CM
    CD14 cDNA ORF Clone, Rhesus, N-Myc tag CG90174-NM

    CD14 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD14 cDNA ORF Clone in Cloning Vector, Rat RG80308-G
    CD14 cDNA ORF Clone, Rat, untagged RG80308-UT
    CD14 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80308-ACGLN
    CD14 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80308-ACG
    CD14 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80308-ACR
    CD14 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80308-CF
    CD14 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80308-NF
    CD14 cDNA ORF Clone, Rat, C-His tag RG80308-CH
    CD14 cDNA ORF Clone, Rat, N-His tag RG80308-NH
    CD14 cDNA ORF Clone, Rat, C-HA tag RG80308-CY
    CD14 cDNA ORF Clone, Rat, N-HA tag RG80308-NY
    CD14 cDNA ORF Clone, Rat, C-Myc tag RG80308-CM
    CD14 cDNA ORF Clone, Rat, N-Myc tag RG80308-NM
    CD14 qPCR Primer Pairs, Rat RP300391

    CD14 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD14 cDNA ORF Clone in Cloning Vector, Mouse MG50023-M
    CD14 cDNA ORF Clone, Mouse, untagged MG50023-UT
    CD14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50023-ACGLN
    CD14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50023-ACG
    CD14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50023-ACR
    CD14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50023-CF
    CD14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50023-NF
    CD14 cDNA ORF Clone, Mouse, C-His tag MG50023-CH
    CD14 cDNA ORF Clone, Mouse, N-His tag MG50023-NH
    CD14 cDNA ORF Clone, Mouse, C-HA tag MG50023-CY
    CD14 cDNA ORF Clone, Mouse, N-HA tag MG50023-NY
    CD14 cDNA ORF Clone, Mouse, C-Myc tag MG50023-CM
    CD14 cDNA ORF Clone, Mouse, N-Myc tag MG50023-NM
    CD14 qPCR Primer Pairs, Mouse MP200023

    CD14 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD14 cDNA ORF Clone in Cloning Vector, Human HG10073-M
    CD14 cDNA ORF Clone, Human, untagged HG10073-UT
    CD14 cDNA ORF Clone, Human, C-GFPSpark® tag HG10073-ACG
    CD14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10073-ACGLN
    CD14 cDNA ORF Clone, Human, C-OFPSpark® tag HG10073-ACR
    CD14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10073-CF
    CD14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10073-NF
    CD14 cDNA ORF Clone, Human, C-His tag HG10073-CH
    CD14 cDNA ORF Clone, Human, N-His tag HG10073-NH
    CD14 cDNA ORF Clone, Human, C-HA tag HG10073-CY
    CD14 cDNA ORF Clone, Human, N-HA tag HG10073-NY
    CD14 cDNA ORF Clone, Human, C-Myc tag HG10073-CM
    CD14 cDNA ORF Clone, Human, N-Myc tag HG10073-NM
    CD14 qPCR Primer Pairs, Human HP100159
    info info
    添加购物车成功! 添加购物车失败!