CCT8/TCP1 theta cDNA ORF Clone, Ferret, N-DDK (Flag®) tag

Cat: FG60078-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CCT8/TCP1 theta Reagents
CRO Services
Product recommended

All CCT8/TCP1 theta Reagents
CCT8/TCP1 theta cDNA ORF Clone, Ferret, N-DDK (Flag®) tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1647 bp
Description
Full length Clone DNA of Ferret chaperonin containing TCP1, subunit 8 (theta) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCT8/TCP1 theta Background Information
Full Name
chaperonin containing TCP1, subunit 8 (theta)

CCT8/TCP1 theta cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
CCT8/TCP1 theta cDNA ORF Clone in Cloning Vector, Ferret FG60078-G
CCT8/TCP1 theta cDNA ORF Clone, Ferret, untagged FG60078-UT
CCT8/TCP1 theta cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60078-ACG
CCT8/TCP1 theta Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60078-ACGLN
CCT8/TCP1 theta cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60078-ANG
CCT8/TCP1 theta cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60078-ACR
CCT8/TCP1 theta cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60078-ANR
CCT8/TCP1 theta cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60078-CF
CCT8/TCP1 theta cDNA ORF Clone, Ferret, C-His tag FG60078-CH
CCT8/TCP1 theta cDNA ORF Clone, Ferret, N-His tag FG60078-NH
CCT8/TCP1 theta cDNA ORF Clone, Ferret, C-HA tag FG60078-CY
CCT8/TCP1 theta cDNA ORF Clone, Ferret, N-HA tag FG60078-NY
CCT8/TCP1 theta cDNA ORF Clone, Ferret, C-Myc tag FG60078-CM
CCT8/TCP1 theta cDNA ORF Clone, Ferret, N-Myc tag FG60078-NM

CCT8/TCP1 theta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCT8/TCP1 theta cDNA ORF Clone in Cloning Vector, Mouse MG52190-G
CCT8/TCP1 theta cDNA ORF Clone, Mouse, untagged MG52190-UT
CCT8/TCP1 theta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52190-ACG
CCT8/TCP1 theta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52190-ACGLN
CCT8/TCP1 theta cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52190-ANG
CCT8/TCP1 theta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52190-ACR
CCT8/TCP1 theta cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52190-ANR
CCT8/TCP1 theta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52190-CF
CCT8/TCP1 theta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52190-NF
CCT8/TCP1 theta cDNA ORF Clone, Mouse, C-His tag MG52190-CH
CCT8/TCP1 theta cDNA ORF Clone, Mouse, N-His tag MG52190-NH
CCT8/TCP1 theta cDNA ORF Clone, Mouse, C-HA tag MG52190-CY
CCT8/TCP1 theta cDNA ORF Clone, Mouse, N-HA tag MG52190-NY
CCT8/TCP1 theta cDNA ORF Clone, Mouse, C-Myc tag MG52190-CM
CCT8/TCP1 theta cDNA ORF Clone, Mouse, N-Myc tag MG52190-NM
CCT8/TCP1 theta qPCR Primer Pairs, Mouse MP202063

CCT8/TCP1 theta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCT8/TCP1 theta cDNA ORF Clone in Cloning Vector, Human HG11492-U
CCT8/TCP1 theta cDNA ORF Clone, Human, untagged HG11492-UT
CCT8/TCP1 theta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11492-ACGLN
CCT8/TCP1 theta cDNA ORF Clone, Human, C-GFPSpark® tag HG11492-ACG
CCT8/TCP1 theta cDNA ORF Clone, Human, N-GFPSpark® tag HG11492-ANG
CCT8/TCP1 theta cDNA ORF Clone, Human, C-OFPSpark® tag HG11492-ACR
CCT8/TCP1 theta cDNA ORF Clone, Human, N-OFPSpark® tag HG11492-ANR
CCT8/TCP1 theta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11492-CF
CCT8/TCP1 theta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11492-NF
CCT8/TCP1 theta cDNA ORF Clone, Human, C-His tag HG11492-CH
CCT8/TCP1 theta cDNA ORF Clone, Human, N-His tag HG11492-NH
CCT8/TCP1 theta cDNA ORF Clone, Human, C-HA tag HG11492-CY
CCT8/TCP1 theta cDNA ORF Clone, Human, N-HA tag HG11492-NY
CCT8/TCP1 theta cDNA ORF Clone, Human, C-Myc tag HG11492-CM
CCT8/TCP1 theta cDNA ORF Clone, Human, N-Myc tag HG11492-NM
CCT8/TCP1 theta qPCR Primer Pairs, Human HP101368
info info
添加购物车成功! 添加购物车失败!