C1QA cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60041-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All C1QA Reagents
CRO Services
Product recommended

All C1QA Reagents
C1QA cDNA ORF Clone, Ferret, N-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Ferret complement component 1, q subcomponent, A chain with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C1QA Background Information
Full Name
complement component 1, q subcomponent, A chain

C1QA cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
C1QA cDNA ORF Clone in Cloning Vector, Ferret FG60041-G
C1QA cDNA ORF Clone, Ferret, untagged FG60041-UT
C1QA Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60041-ACGLN
C1QA cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60041-ACG
C1QA cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60041-ANG
C1QA cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60041-ACR
C1QA cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60041-ANR
C1QA cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60041-CF
C1QA cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60041-NF
C1QA cDNA ORF Clone, Ferret, C-His tag FG60041-CH
C1QA cDNA ORF Clone, Ferret, N-His tag FG60041-NH
C1QA cDNA ORF Clone, Ferret, C-HA tag FG60041-CY
C1QA cDNA ORF Clone, Ferret, C-Myc tag FG60041-CM
C1QA cDNA ORF Clone, Ferret, N-Myc tag FG60041-NM

C1QA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
C1QA cDNA ORF Clone in Cloning Vector, Mouse MG53730-U
C1QA cDNA ORF Clone, Mouse, untagged MG53730-UT
C1QA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53730-ACG
C1QA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53730-ACGLN
C1QA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53730-ACR
C1QA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53730-CF
C1QA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53730-NF
C1QA cDNA ORF Clone, Mouse, C-His tag MG53730-CH
C1QA cDNA ORF Clone, Mouse, N-His tag MG53730-NH
C1QA cDNA ORF Clone, Mouse, C-HA tag MG53730-CY
C1QA cDNA ORF Clone, Mouse, N-HA tag MG53730-NY
C1QA cDNA ORF Clone, Mouse, C-Myc tag MG53730-CM
C1QA cDNA ORF Clone, Mouse, N-Myc tag MG53730-NM
info info
添加购物车成功! 添加购物车失败!