Beta-2 microglobulin cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60069-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Beta-2 microglobulin Reagents
CRO Services
Product recommended

All Beta-2 microglobulin Reagents
Beta-2 microglobulin cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
387 bp
Description
Full length Clone DNA of Ferret beta-2-microglobulin with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Beta-2 microglobulin Background Information

B2M, also known as β2-Microglobulin or CDABP0092, is a component of MHC class I molecules found expression in all nucleated cells (excludes red blood cells). The major function of MHC class I moleculesis is to display fragments of proteins from within the cell to T-cells and cells containing foreign proteins will be attacked. B2M(β2-Microglobulin) is a low molecular weight protein. It was demonstrated that B2M(β2-Microglobulin) was localized in the membranes of nucleated cells and was found to be associated with HL-A antigens.B2M(β2- Microglobulin) is present in free form in various body fluids and as a subunit of histocompatibility antigens on cell surfaces lateral to theα3 chain. Unlikeα3, β2 has no transmembrane region. Directly above β2 lies the α1 chain, which itself is lateral to the α2. In the absence of B2M(β2 microglobulin), very limited amounts of MHC class I (classical and non-classical) molecules can be detected on the surface. In the absence of MHC class I, CD8 T cells, a subset of T cells involved in the development of acquired immunity cannot develop. Low levels of B2M(β2 microglobulin) can indicate non-progression of HIV.

Full Name
beta-2 microglobulin
References
  • Poulik MD, et al. (1979) Beta 2-Microglobulin: methods and clinical applications. CRC Ctit Rev Clin Lab Sci. 10(3): 225-45.
  • Poulik MD, et al. (1975) Beta2-Microglobulins. Contemp Top Mol Immunol. 4: 157-204.
  • Berggard I. (1976) Beta2-Microglobulins: isolation, properties, and distribution. Fed Proc. 35(5): 1167-70.
  • Beta-2 microglobulin cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Beta-2 microglobulin cDNA ORF Clone in Cloning Vector, Rhesus CG90152-G
    Beta-2 microglobulin cDNA ORF Clone, Rhesus, untagged CG90152-UT
    Beta-2 microglobulin Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90152-ACGLN
    Beta-2 microglobulin cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90152-ACG
    Beta-2 microglobulin cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90152-ACR
    Beta-2 microglobulin cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90152-CF
    Beta-2 microglobulin cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90152-NF
    Beta-2 microglobulin cDNA ORF Clone, Rhesus, C-His tag CG90152-CH
    Beta-2 microglobulin cDNA ORF Clone, Rhesus, N-His tag CG90152-NH
    Beta-2 microglobulin cDNA ORF Clone, Rhesus, C-HA tag CG90152-CY
    Beta-2 microglobulin cDNA ORF Clone, Rhesus, N-HA tag CG90152-NY
    Beta-2 microglobulin cDNA ORF Clone, Rhesus, C-Myc tag CG90152-CM
    Beta-2 microglobulin cDNA ORF Clone, Rhesus, N-Myc tag CG90152-NM

    Beta-2 microglobulin cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    Beta-2 microglobulin cDNA ORF Clone in Cloning Vector, Ferret FG60069-G
    Beta-2 microglobulin cDNA ORF Clone, Ferret, untagged FG60069-UT
    Beta-2 microglobulin Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60069-ACGLN
    Beta-2 microglobulin cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60069-ACG
    Beta-2 microglobulin cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60069-ACR
    Beta-2 microglobulin cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60069-CF
    Beta-2 microglobulin cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60069-NF
    Beta-2 microglobulin cDNA ORF Clone, Ferret, C-His tag FG60069-CH
    Beta-2 microglobulin cDNA ORF Clone, Ferret, N-His tag FG60069-NH
    Beta-2 microglobulin cDNA ORF Clone, Ferret, C-HA tag FG60069-CY
    Beta-2 microglobulin cDNA ORF Clone, Ferret, N-HA tag FG60069-NY
    Beta-2 microglobulin cDNA ORF Clone, Ferret, N-Myc tag FG60069-NM

    Beta-2 microglobulin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Beta-2 microglobulin cDNA ORF Clone in Cloning Vector, Rat RG80423-G
    Beta-2 microglobulin cDNA ORF Clone, Rat, untagged RG80423-UT
    Beta-2 microglobulin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80423-ACGLN
    Beta-2 microglobulin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80423-ACG
    Beta-2 microglobulin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80423-ACR
    Beta-2 microglobulin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80423-CF
    Beta-2 microglobulin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80423-NF
    Beta-2 microglobulin cDNA ORF Clone, Rat, C-His tag RG80423-CH
    Beta-2 microglobulin cDNA ORF Clone, Rat, N-His tag RG80423-NH
    Beta-2 microglobulin cDNA ORF Clone, Rat, C-HA tag RG80423-CY
    Beta-2 microglobulin cDNA ORF Clone, Rat, N-HA tag RG80423-NY
    Beta-2 microglobulin cDNA ORF Clone, Rat, C-Myc tag RG80423-CM
    Beta-2 microglobulin cDNA ORF Clone, Rat, N-Myc tag RG80423-NM
    Beta-2 microglobulin qPCR Primer Pairs, Rat RP300396

    Beta-2 microglobulin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Beta-2 microglobulin cDNA ORF Clone in Cloning Vector, Mouse MG50957-G
    Beta-2 microglobulin cDNA ORF Clone, Mouse, untagged MG50957-UT
    Beta-2 microglobulin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50957-ACGLN
    Beta-2 microglobulin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50957-ACG
    Beta-2 microglobulin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50957-ACR
    Beta-2 microglobulin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50957-CF
    Beta-2 microglobulin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50957-NF
    Beta-2 microglobulin cDNA ORF Clone, Mouse, C-His tag MG50957-CH
    Beta-2 microglobulin cDNA ORF Clone, Mouse, N-His tag MG50957-NH
    Beta-2 microglobulin cDNA ORF Clone, Mouse, C-HA tag MG50957-CY
    Beta-2 microglobulin cDNA ORF Clone, Mouse, N-HA tag MG50957-NY
    Beta-2 microglobulin cDNA ORF Clone, Mouse, C-Myc tag MG50957-CM
    Beta-2 microglobulin cDNA ORF Clone, Mouse, N-Myc tag MG50957-NM
    Beta-2 microglobulin qPCR Primer Pairs, Mouse MP200926

    Beta-2 microglobulin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Beta-2 microglobulin cDNA ORF Clone in Cloning Vector, Human HG11976-G
    Beta-2 microglobulin cDNA ORF Clone, Human, untagged HG11976-UT
    Beta-2 microglobulin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11976-ACGLN
    Beta-2 microglobulin cDNA ORF Clone, Human, C-GFPSpark® tag HG11976-ACG
    Beta-2 microglobulin cDNA ORF Clone, Human, C-OFPSpark® tag HG11976-ACR
    Beta-2 microglobulin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11976-CF
    Beta-2 microglobulin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11976-NF
    Beta-2 microglobulin cDNA ORF Clone, Human, C-His tag HG11976-CH
    Beta-2 microglobulin cDNA ORF Clone, Human, N-His tag HG11976-NH
    Beta-2 microglobulin cDNA ORF Clone, Human, C-HA tag HG11976-CY
    Beta-2 microglobulin cDNA ORF Clone, Human, N-HA tag HG11976-NY
    Beta-2 microglobulin cDNA ORF Clone, Human, C-Myc tag HG11976-CM
    Beta-2 microglobulin cDNA ORF Clone, Human, N-Myc tag HG11976-NM
    Beta-2 microglobulin qPCR Primer Pairs, Human HP100002
    info info
    添加购物车成功! 添加购物车失败!