Shiga toxin II subunit B cDNA ORF Clone, E. coli, C-HA tag

Cat: EG40019-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Shiga toxin II subunit B Reagents
CRO Services

All Shiga toxin II subunit B Reagents
Shiga toxin II subunit B cDNA ORF Clone, E. coli, C-HA tag General Information
Gene
Species
E. coli
RefSeq ORF Size
1281 bp
Description
Full length Clone DNA of E. coli O104:H4 STX2 gene for Shiga toxin 2 A subunit (stx2A) and Shiga toxin 2 B subunit (stx2B) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Shiga toxin II subunit B cDNA ORF Clone, E. coli, C-HA tag Alternative Names
stx2dB cDNA ORF Clone, E. coli;stx2gB cDNA ORF Clone, E. coli
Shiga toxin II subunit B Background Information

E. Coli STX2B is a subunit of Stx2. Stx2, together with Stx1, formed a family of related toxins which are known as shiga toxins. Shiga toxins are mainly produced by the bacteria S. dysenteriae and the Shigatoxigenic group of Escherichia coli, which includes serotypes O157:H7, O104:H4, and other enterohemorrhagic E. coli (EHEC). A total of 3222 outbreak cases (including 39 deaths) have been reported in northern Germany in May through June 2011. The outbreak strain was typed as an enteroaggregative Shiga-toxin–producing E. coli O104:H4, producing extended-spectrum beta-lactamase. The toxin has two subunits—A and B. E. Coli STX2B is the B subunit. It is a pentamer that binds to specific glycolipids on the host cell, specifically globotriaosylceramide. Following this, the A subunit is internalised and cleaved into two parts. Stx2 has been found to be approximately 400 times more toxic (as quantified by LD50 in mice) than Stx-1. The Stx1 and Stx2 B subunits form a pentameric structure that binds to globotriaosylceramidereceptors on eukaryotic cells and promotes endocytosis

References
  • Obata F. et al. (2008) Shiga Toxin 2 Affects the Central Nervous System through Receptor Globotriaosylceramide Localized to Neurons. J Infect Dis. 198 (9): 1398-406.
  • Tironi-Farinati C. et al. (2010) Intracerebroventricular Shiga toxin 2 increases the expression of its receptor globotriaosylceramide and causes dendritic abnormalities. J Neuroimmunol. 222 (1-2): 48-61.
  • Asakura H. et al. (2001) Phylogenetic diversity and similarity of active sites of Shiga toxin (stx) in Shiga toxin-producing Escherichia coli (STEC) isolates from humans and animals. Epidemiol Infect. 127 (1): 27-36.
  • Shiga toxin II subunit B cDNA ORF Clone, E. coli, Related Products

    Product Name Catalog#(PDF)
    Shiga toxin II subunit B cDNA ORF Clone in Cloning Vector, E. coli EG40019-G
    info info
    添加购物车成功! 添加购物车失败!