ZNHIT1 cDNA ORF Clone, Rhesus, C-HA tag

Cat: CG90390-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ZNHIT1 Reagents

CRO Services

Product recommended


All ZNHIT1 Reagents

ZNHIT1 cDNA ORF Clone, Rhesus, C-HA tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
465 bp
Description
Full length Clone DNA of Rhesus zinc finger, HIT-type containing 1 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZNHIT1 Background Information

Full Name
zinc finger, HIT-type containing 1

ZNHIT1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ZNHIT1 cDNA ORF Clone in Cloning Vector, Rhesus CG90390-G
ZNHIT1 cDNA ORF Clone, Rhesus, untagged CG90390-UT
ZNHIT1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90390-ACGLN
ZNHIT1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90390-ACG
ZNHIT1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90390-ANG
ZNHIT1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90390-ACR
ZNHIT1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90390-ANR
ZNHIT1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90390-CF
ZNHIT1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90390-NF
ZNHIT1 cDNA ORF Clone, Rhesus, C-His tag CG90390-CH
ZNHIT1 cDNA ORF Clone, Rhesus, N-His tag CG90390-NH
ZNHIT1 cDNA ORF Clone, Rhesus, N-HA tag CG90390-NY
ZNHIT1 cDNA ORF Clone, Rhesus, C-Myc tag CG90390-CM
ZNHIT1 cDNA ORF Clone, Rhesus, N-Myc tag CG90390-NM

ZNHIT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ZNHIT1 cDNA ORF Clone in Cloning Vector, Human HG17209-U
ZNHIT1 cDNA ORF Clone, Human, untagged HG17209-UT
ZNHIT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17209-ACGLN
ZNHIT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17209-ACG
ZNHIT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17209-ANG
ZNHIT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17209-ACR
ZNHIT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17209-ANR
ZNHIT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17209-CF
ZNHIT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17209-NF
ZNHIT1 cDNA ORF Clone, Human, C-His tag HG17209-CH
ZNHIT1 cDNA ORF Clone, Human, N-His tag HG17209-NH
ZNHIT1 cDNA ORF Clone, Human, C-HA tag HG17209-CY
ZNHIT1 cDNA ORF Clone, Human, N-HA tag HG17209-NY
ZNHIT1 cDNA ORF Clone, Human, C-Myc tag HG17209-CM
ZNHIT1 cDNA ORF Clone, Human, N-Myc tag HG17209-NM
info info
添加购物车成功! 添加购物车失败!