SCN2B cDNA ORF Clone, Cynomolgus, C-His tag

Cat: CG90365-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SCN2B Reagents
CRO Services
Product recommended

All SCN2B Reagents
SCN2B cDNA ORF Clone, Cynomolgus, C-His tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
648 bp
Description
Full length Clone DNA of Cynomolgus sodium channel, voltage-gated, type II, beta subunit with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SCN2B Background Information

SCN2B plays a key role in the assembly, expression, and functional modulation of the heterotrimeric complex of the sodium channel. Voltage-gated sodium channels (NaV) are composed of one pore-forming alpha-subunit, which may be associated with either one or more beta-subunits. Alpha-subunits are composed for four homologous domains, each of which contains six transmembrane segments.They are responsible for action potential initiation and propagation in excitable cells, including nerve, muscle, and neuroendocrine cell types. SCN2B causes an increase in the plasma membrane surface area and in its folding into microvilli. SCN2B also interacts with TNR and may play a crucial role in clustering and regulation of activity of sodium channels at nodes of ranvier.

Full Name
sodium channel, voltage gated, type II beta subunit
References
  • Kimura K, et al. (2006) Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. Genome Res. 16(1):55-65.
  • Tan BH, et al. (2010) Sudden infant death syndrome-associated mutations in the sodium channel beta subunits. Heart Rhythm. 7(6):771-8.
  • Watanabe H, et al. (2009) Mutations in sodium channel beta1- and beta2-subunits associated with atrial fibrillation. Circ Arrhythm Electrophysiol. 2(3):268-75. Kimura K et al., 2006, Genome Res. 16(1):55-65.
  • SCN2B cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    SCN2B cDNA ORF Clone in Cloning Vector, Cynomolgus CG90365-G
    SCN2B cDNA ORF Clone, Cynomolgus, untagged CG90365-UT
    SCN2B Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90365-ACGLN
    SCN2B cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90365-ACG
    SCN2B cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90365-ACR
    SCN2B cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90365-CF
    SCN2B cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90365-NF
    SCN2B cDNA ORF Clone, Cynomolgus, N-His tag CG90365-NH
    SCN2B cDNA ORF Clone, Cynomolgus, C-HA tag CG90365-CY
    SCN2B cDNA ORF Clone, Cynomolgus, N-HA tag CG90365-NY
    SCN2B cDNA ORF Clone, Cynomolgus, C-Myc tag CG90365-CM
    SCN2B cDNA ORF Clone, Cynomolgus, N-Myc tag CG90365-NM

    SCN2B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SCN2B cDNA ORF Clone in Cloning Vector, Human HG13859-G
    SCN2B cDNA ORF Clone, Human, untagged HG13859-UT
    SCN2B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13859-ACGLN
    SCN2B cDNA ORF Clone, Human, C-GFPSpark® tag HG13859-ACG
    SCN2B cDNA ORF Clone, Human, C-OFPSpark® tag HG13859-ACR
    SCN2B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13859-CF
    SCN2B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13859-NF
    SCN2B cDNA ORF Clone, Human, C-His tag HG13859-CH
    SCN2B cDNA ORF Clone, Human, N-His tag HG13859-NH
    SCN2B cDNA ORF Clone, Human, C-HA tag HG13859-CY
    SCN2B cDNA ORF Clone, Human, N-HA tag HG13859-NY
    SCN2B cDNA ORF Clone, Human, C-Myc tag HG13859-CM
    SCN2B cDNA ORF Clone, Human, N-Myc tag HG13859-NM
    SCN2B qPCR Primer Pairs, Human HP102531
    info info
    添加购物车成功! 添加购物车失败!