RNASE4 cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90602-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RNASE4 Reagents
CRO Services
Product recommended

All RNASE4 Reagents
RNASE4 cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Rhesus ribonuclease, RNase A family, 4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNASE4 Background Information
Full Name
ribonuclease A family member 4

RNASE4 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RNASE4 cDNA ORF Clone in Cloning Vector, Rhesus CG90602-G
RNASE4 cDNA ORF Clone, Rhesus, untagged CG90602-UT
RNASE4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90602-ACGLN
RNASE4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90602-ACG
RNASE4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90602-ACR
RNASE4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90602-CF
RNASE4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90602-NF
RNASE4 cDNA ORF Clone, Rhesus, C-His tag CG90602-CH
RNASE4 cDNA ORF Clone, Rhesus, C-HA tag CG90602-CY
RNASE4 cDNA ORF Clone, Rhesus, N-HA tag CG90602-NY
RNASE4 cDNA ORF Clone, Rhesus, C-Myc tag CG90602-CM
RNASE4 cDNA ORF Clone, Rhesus, N-Myc tag CG90602-NM

RNASE4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RNASE4 cDNA ORF Clone in Cloning Vector, Rat RG86360-U
RNASE4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86360-ACGLN

RNASE4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNASE4 cDNA ORF Clone in Cloning Vector, Mouse MG5A1221-U
RNASE4 cDNA ORF Clone, Mouse, untagged MG5A1221-UT
RNASE4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1221-ACGLN
RNASE4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1221-ACG
RNASE4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1221-ACR
RNASE4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1221-CF
RNASE4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1221-NF
RNASE4 cDNA ORF Clone, Mouse, C-His tag MG5A1221-CH
RNASE4 cDNA ORF Clone, Mouse, N-His tag MG5A1221-NH
RNASE4 cDNA ORF Clone, Mouse, C-HA tag MG5A1221-CY
RNASE4 cDNA ORF Clone, Mouse, N-HA tag MG5A1221-NY
RNASE4 cDNA ORF Clone, Mouse, C-Myc tag MG5A1221-CM
RNASE4 cDNA ORF Clone, Mouse, N-Myc tag MG5A1221-NM

RNASE4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNASE4 cDNA ORF Clone in Cloning Vector, Human HG13339-G
RNASE4 cDNA ORF Clone, Human, untagged HG13339-UT
RNASE4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13339-ACGLN
RNASE4 cDNA ORF Clone, Human, C-GFPSpark® tag HG13339-ACG
RNASE4 cDNA ORF Clone, Human, C-OFPSpark® tag HG13339-ACR
RNASE4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13339-CF
RNASE4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13339-NF
RNASE4 cDNA ORF Clone, Human, C-His tag HG13339-CH
RNASE4 cDNA ORF Clone, Human, N-His tag HG13339-NH
RNASE4 cDNA ORF Clone, Human, C-HA tag HG13339-CY
RNASE4 cDNA ORF Clone, Human, N-HA tag HG13339-NY
RNASE4 cDNA ORF Clone, Human, C-Myc tag HG13339-CM
RNASE4 cDNA ORF Clone, Human, N-Myc tag HG13339-NM
RNASE4 qPCR Primer Pairs, Human HP102044
info info
添加购物车成功! 添加购物车失败!