PPAN cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90653-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PPAN Reagents
CRO Services
Product recommended

All PPAN Reagents
PPAN cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1416 bp
Description
Full length Clone DNA of Rhesus peter pan homolog (Drosophila) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPAN Background Information
Full Name
peter pan homolog (Drosophila)

PPAN cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
PPAN cDNA ORF Clone in Cloning Vector, Rhesus CG90653-G
PPAN cDNA ORF Clone, Rhesus, untagged CG90653-UT
PPAN cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90653-ACG
PPAN Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90653-ACGLN
PPAN cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90653-ANG
PPAN cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90653-ACR
PPAN cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90653-ANR
PPAN cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90653-CF
PPAN cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90653-NF
PPAN cDNA ORF Clone, Rhesus, C-His tag CG90653-CH
PPAN cDNA ORF Clone, Rhesus, N-His tag CG90653-NH
PPAN cDNA ORF Clone, Rhesus, C-HA tag CG90653-CY
PPAN cDNA ORF Clone, Rhesus, N-HA tag CG90653-NY
PPAN cDNA ORF Clone, Rhesus, C-Myc tag CG90653-CM

PPAN cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPAN cDNA ORF Clone in Cloning Vector, Human HG21747-U
PPAN cDNA ORF Clone, Human, untagged HG21747-UT
PPAN Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21747-ACGLN
PPAN cDNA ORF Clone, Human, C-GFPSpark® tag HG21747-ACG
PPAN cDNA ORF Clone, Human, N-GFPSpark® tag HG21747-ANG
PPAN cDNA ORF Clone, Human, C-OFPSpark® tag HG21747-ACR
PPAN cDNA ORF Clone, Human, N-OFPSpark® tag HG21747-ANR
PPAN cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21747-CF
PPAN cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21747-NF
PPAN cDNA ORF Clone, Human, C-His tag HG21747-CH
PPAN cDNA ORF Clone, Human, N-His tag HG21747-NH
PPAN cDNA ORF Clone, Human, C-HA tag HG21747-CY
PPAN cDNA ORF Clone, Human, N-HA tag HG21747-NY
PPAN cDNA ORF Clone, Human, C-Myc tag HG21747-CM
PPAN cDNA ORF Clone, Human, N-Myc tag HG21747-NM
info info
添加购物车成功! 添加购物车失败!