REA cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90613-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All REA Reagents
CRO Services
Product recommended

All REA Reagents
REA cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
900 bp
Description
Full length Clone DNA of Rhesus prohibitin 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

REA Background Information
Full Name
prohibitin 2

REA cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
REA cDNA ORF Clone in Cloning Vector, Rhesus CG90613-G
REA cDNA ORF Clone, Rhesus, untagged CG90613-UT
REA cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90613-ACG
REA Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90613-ACGLN
REA cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90613-ANG
REA cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90613-ACR
REA cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90613-ANR
REA cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90613-CF
REA cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90613-NF
REA cDNA ORF Clone, Rhesus, C-His tag CG90613-CH
REA cDNA ORF Clone, Rhesus, C-HA tag CG90613-CY
REA cDNA ORF Clone, Rhesus, N-HA tag CG90613-NY
REA cDNA ORF Clone, Rhesus, C-Myc tag CG90613-CM
REA cDNA ORF Clone, Rhesus, N-Myc tag CG90613-NM

REA cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
REA cDNA ORF Clone in Cloning Vector, Ferret FG60141-G
REA cDNA ORF Clone, Ferret, untagged FG60141-UT
REA cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60141-ACG
REA Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60141-ACGLN
REA cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60141-ANG
REA cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60141-ACR
REA cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60141-ANR
REA cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60141-CF
REA cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60141-NF
REA cDNA ORF Clone, Ferret, C-His tag FG60141-CH
REA cDNA ORF Clone, Ferret, N-His tag FG60141-NH
REA cDNA ORF Clone, Ferret, C-HA tag FG60141-CY
REA cDNA ORF Clone, Ferret, N-HA tag FG60141-NY
REA cDNA ORF Clone, Ferret, C-Myc tag FG60141-CM
REA cDNA ORF Clone, Ferret, N-Myc tag FG60141-NM

REA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
REA cDNA ORF Clone in Cloning Vector, Rat RG84986-U
REA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84986-ACGLN

REA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
REA cDNA ORF Clone in Cloning Vector, Mouse MG52456-G
REA cDNA ORF Clone, Mouse, untagged MG52456-UT
REA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52456-ACGLN
REA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52456-ACG
REA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52456-ANG
REA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52456-ACR
REA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52456-ANR
REA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52456-CF
REA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52456-NF
REA cDNA ORF Clone, Mouse, C-His tag MG52456-CH
REA cDNA ORF Clone, Mouse, N-His tag MG52456-NH
REA cDNA ORF Clone, Mouse, C-HA tag MG52456-CY
REA cDNA ORF Clone, Mouse, N-HA tag MG52456-NY
REA cDNA ORF Clone, Mouse, C-Myc tag MG52456-CM
REA cDNA ORF Clone, Mouse, N-Myc tag MG52456-NM
REA qPCR Primer Pairs, Mouse MP202329

REA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
REA cDNA ORF Clone in Cloning Vector, Human HG16502-G
REA cDNA ORF Clone, Human, untagged HG16502-UT
REA cDNA ORF Clone, Human, C-GFPSpark® tag HG16502-ACG
REA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16502-ACGLN
REA cDNA ORF Clone, Human, N-GFPSpark® tag HG16502-ANG
REA cDNA ORF Clone, Human, C-OFPSpark® tag HG16502-ACR
REA cDNA ORF Clone, Human, N-OFPSpark® tag HG16502-ANR
REA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16502-CF
REA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16502-NF
REA cDNA ORF Clone, Human, C-His tag HG16502-CH
REA cDNA ORF Clone, Human, N-His tag HG16502-NH
REA cDNA ORF Clone, Human, C-HA tag HG16502-CY
REA cDNA ORF Clone, Human, N-HA tag HG16502-NY
REA cDNA ORF Clone, Human, C-Myc tag HG16502-CM
REA cDNA ORF Clone, Human, N-Myc tag HG16502-NM
REA qPCR Primer Pairs, Human HP104907
info info
添加购物车成功! 添加购物车失败!