PFKM cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag

Cat: CG90449-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PFKM Reagents
CRO Services
Product recommended

All PFKM Reagents
PFKM cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
2343 bp
Description
Full length Clone DNA of Cynomolgus phosphofructokinase, muscle with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PFKM Background Information

PFK1, also known as PFKM, is a regulatory glycolytic enzyme. PFK1 converts fructose 6-phosphate and ATP into fructose 1,6-bisphosphate (through PFK-1), fructose 2,6-bisphosphate (through PFK-2) and ADP. It is a muscle-type isozyme. There are three phosphofructokinase isozymes in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Mutations in PFK1 gene have been related with glycogen storage disease type VII, also identified as Tarui disease.

Full Name
phosphofructokinase, muscle
References
  • Yamasaki T., et al.,(1991), Structure of the entire human muscle phosphofructokinase-encoding gene: a two-promoter system. Gene 104:277-282.
  • Sharma P.M., et al., (1989), Cloning and expression of a human muscle phosphofructokinase cDNA.Gene 77:177-183.
  • Nakajima H., et al.,(1987), Cloning of human muscle phosphofructokinase cDNA.FEBS Lett. 223:113-116.
  • PFKM cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    PFKM cDNA ORF Clone in Cloning Vector, Cynomolgus CG90449-G
    PFKM cDNA ORF Clone, Cynomolgus, untagged CG90449-UT
    PFKM Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90449-ACGLN
    PFKM cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90449-ACG
    PFKM cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90449-ANG
    PFKM cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90449-ACR
    PFKM cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90449-ANR
    PFKM cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90449-CF
    PFKM cDNA ORF Clone, Cynomolgus, C-His tag CG90449-CH
    PFKM cDNA ORF Clone, Cynomolgus, N-His tag CG90449-NH
    PFKM cDNA ORF Clone, Cynomolgus, C-HA tag CG90449-CY
    PFKM cDNA ORF Clone, Cynomolgus, N-HA tag CG90449-NY
    PFKM cDNA ORF Clone, Cynomolgus, C-Myc tag CG90449-CM
    PFKM cDNA ORF Clone, Cynomolgus, N-Myc tag CG90449-NM

    PFKM cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PFKM cDNA ORF Clone in Cloning Vector, Mouse MG52541-G
    PFKM cDNA ORF Clone in Cloning Vector, Mouse MG5A7617-U
    PFKM cDNA ORF Clone, Mouse, untagged MG52541-UT
    PFKM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52541-ACGLN
    PFKM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52541-ACG
    PFKM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7617-ACGLN
    PFKM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52541-ANG
    PFKM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52541-ACR
    PFKM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52541-ANR
    PFKM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52541-CF
    PFKM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52541-NF
    PFKM cDNA ORF Clone, Mouse, C-His tag MG52541-CH
    PFKM cDNA ORF Clone, Mouse, N-His tag MG52541-NH
    PFKM cDNA ORF Clone, Mouse, C-HA tag MG52541-CY
    PFKM cDNA ORF Clone, Mouse, N-HA tag MG52541-NY
    PFKM cDNA ORF Clone, Mouse, C-Myc tag MG52541-CM
    PFKM cDNA ORF Clone, Mouse, N-Myc tag MG52541-NM
    PFKM qPCR Primer Pairs, Mouse MP202414

    PFKM cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PFKM cDNA ORF Clone in Cloning Vector, Human HG14133-G
    PFKM cDNA ORF Clone, Human, untagged HG14133-UT
    PFKM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14133-ACGLN
    PFKM cDNA ORF Clone, Human, C-GFPSpark® tag HG14133-ACG
    PFKM cDNA ORF Clone, Human, N-GFPSpark® tag HG14133-ANG
    PFKM cDNA ORF Clone, Human, C-OFPSpark® tag HG14133-ACR
    PFKM cDNA ORF Clone, Human, N-OFPSpark® tag HG14133-ANR
    PFKM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14133-CF
    PFKM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14133-NF
    PFKM cDNA ORF Clone, Human, C-His tag HG14133-CH
    PFKM cDNA ORF Clone, Human, N-His tag HG14133-NH
    PFKM cDNA ORF Clone, Human, C-HA tag HG14133-CY
    PFKM cDNA ORF Clone, Human, N-HA tag HG14133-NY
    PFKM cDNA ORF Clone, Human, C-Myc tag HG14133-CM
    PFKM cDNA ORF Clone, Human, N-Myc tag HG14133-NM
    PFKM qPCR Primer Pairs, Human HP102786
    info info
    添加购物车成功! 添加购物车失败!