NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, untagged

Cat: CG90764-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NEU1/Neuraminidase1 Reagents
CRO Services
Product recommended

All NEU1/Neuraminidase1 Reagents
NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, untagged General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1251 bp
Description
Full length Clone DNA of Rhesus sialidase 1 (lysosomal sialidase).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NEU1/Neuraminidase1 Background Information
Full Name
sialidase 1 (lysosomal sialidase)

NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
NEU1/Neuraminidase1 cDNA ORF Clone in Cloning Vector, Rhesus CG90764-G
NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90764-ACG
NEU1/Neuraminidase1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90764-ACGLN
NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90764-ACR
NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90764-CF
NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90764-NF
NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, C-His tag CG90764-CH
NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, N-His tag CG90764-NH
NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, C-HA tag CG90764-CY
NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, N-HA tag CG90764-NY
NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, C-Myc tag CG90764-CM
NEU1/Neuraminidase1 cDNA ORF Clone, Rhesus, N-Myc tag CG90764-NM

NEU1/Neuraminidase1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NEU1/Neuraminidase1 cDNA ORF Clone in Cloning Vector, Human HG13268-G
NEU1/Neuraminidase1 cDNA ORF Clone, Human, untagged HG13268-UT
NEU1/Neuraminidase1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13268-ACG
NEU1/Neuraminidase1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13268-ACGLN
NEU1/Neuraminidase1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13268-ACR
NEU1/Neuraminidase1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13268-CF
NEU1/Neuraminidase1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13268-NF
NEU1/Neuraminidase1 cDNA ORF Clone, Human, C-His tag HG13268-CH
NEU1/Neuraminidase1 cDNA ORF Clone, Human, N-His tag HG13268-NH
NEU1/Neuraminidase1 cDNA ORF Clone, Human, C-HA tag HG13268-CY
NEU1/Neuraminidase1 cDNA ORF Clone, Human, N-HA tag HG13268-NY
NEU1/Neuraminidase1 cDNA ORF Clone, Human, C-Myc tag HG13268-CM
NEU1/Neuraminidase1 cDNA ORF Clone, Human, N-Myc tag HG13268-NM
NEU1/Neuraminidase1 qPCR Primer Pairs, Human HP101977
info info
添加购物车成功! 添加购物车失败!