Galectin-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Cat: CG90161-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Galectin-1 Reagents

CRO Services

Product recommended


All Galectin-1 Reagents

Galectin-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
408 bp
Description
Full length Clone DNA of Rhesus lectin, galactoside-binding, soluble, 1 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Galectin-1 Background Information

Galectin-1 (Gal-1, GAL1), is a member of the galectins, a family of animal lectins ranging from Caenorhabditis elegans to humans, which is defined by their affinity for beta-galactosides and by significant sequence similarity in the carbohydrate-binding site. It is a homodimer with a subunit molecular mass of 14.5 kDa, which contains six cysteine residues per subunit. The cysteine residues should be in a free state in order to maintain a molecular structure that is capable of showing lectin activity. This endogenous lectin widely expressed at sites of inflammation and tumour growth, has been postulated as an attractive immunosuppressive agent to restore immune cell tolerance and homeostasis in autoimmune and inflammatory settings. On the other hand, galectin-1 contributes to different steps of tumour progression including cell adhesion, migration and tumour-immune escape, suggesting that blockade of galectin-1 might result in therapeutic benefits in cancer. Several potential glycoprotein ligands for galectin-1 have been identified, including lysosome-associated membrane glycoproteins and fibronectin, laminin, as well as T-cell glycoproteins CD43 and CD45. Evidence points to Gal-1 and its ligands as one of the master regulators of such immune responses as T-cell homeostasis and survival, T-cell immune disorders, inflammation and allergies as well as host-pathogen interactions.

Full Name
lectin, galactoside-binding, soluble, 1
References
  • Gaudet AD, et al. (2005) Expression and functions of galectin-1 in sensory and motoneurons. Curr Drug Targets. 6(4): 419-25.
  • Kadoya T, et al. (2006) Structural and functional studies of galectin-1: a novel axonal regeneration-promoting activity for oxidized galectin-1. Curr Drug Targets. 6(4): 375-83.
  • Camby I, et al. (2006) Galectin-1: a small protein with major functions. Glycobiology. 16(11): 137R-157R.
  • Salatino M, et al. (2008) Galectin-1 as a potential therapeutic target in autoimmune disorders and cancer. Expert Opin Biol Ther. 8(1): 45-57.
  • Galectin-1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Galectin-1 cDNA ORF Clone in Cloning Vector, Rhesus CG90161-G
    Galectin-1 cDNA ORF Clone, Rhesus, untagged CG90161-UT
    Galectin-1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90161-ACGLN
    Galectin-1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90161-ACG
    Galectin-1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90161-ACR
    Galectin-1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90161-NF
    Galectin-1 cDNA ORF Clone, Rhesus, C-His tag CG90161-CH
    Galectin-1 cDNA ORF Clone, Rhesus, N-His tag CG90161-NH
    Galectin-1 cDNA ORF Clone, Rhesus, C-HA tag CG90161-CY
    Galectin-1 cDNA ORF Clone, Rhesus, N-HA tag CG90161-NY
    Galectin-1 cDNA ORF Clone, Rhesus, C-Myc tag CG90161-CM
    Galectin-1 cDNA ORF Clone, Rhesus, N-Myc tag CG90161-NM

    Galectin-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Galectin-1 cDNA ORF Clone in Cloning Vector, Rat RG80248-G
    Galectin-1 cDNA ORF Clone, Rat, untagged RG80248-UT
    Galectin-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80248-ACG
    Galectin-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80248-ACGLN
    Galectin-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80248-ACR
    Galectin-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80248-CF
    Galectin-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80248-NF
    Galectin-1 cDNA ORF Clone, Rat, C-His tag RG80248-CH
    Galectin-1 cDNA ORF Clone, Rat, N-His tag RG80248-NH
    Galectin-1 cDNA ORF Clone, Rat, C-HA tag RG80248-CY
    Galectin-1 cDNA ORF Clone, Rat, N-HA tag RG80248-NY
    Galectin-1 cDNA ORF Clone, Rat, C-Myc tag RG80248-CM
    Galectin-1 cDNA ORF Clone, Rat, N-Myc tag RG80248-NM
    Galectin-1 qPCR Primer Pairs, Rat RP300233

    Galectin-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Galectin-1 cDNA ORF Clone in Cloning Vector, Mouse MG50100-M
    Galectin-1 cDNA ORF Clone, Mouse, untagged MG50100-UT
    Galectin-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50100-ACGLN
    Galectin-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50100-ACG
    Galectin-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50100-ACR
    Galectin-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50100-CF
    Galectin-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50100-NF
    Galectin-1 cDNA ORF Clone, Mouse, C-His tag MG50100-CH
    Galectin-1 cDNA ORF Clone, Mouse, N-His tag MG50100-NH
    Galectin-1 cDNA ORF Clone, Mouse, C-HA tag MG50100-CY
    Galectin-1 cDNA ORF Clone, Mouse, N-HA tag MG50100-NY
    Galectin-1 cDNA ORF Clone, Mouse, C-Myc tag MG50100-CM
    Galectin-1 cDNA ORF Clone, Mouse, N-Myc tag MG50100-NM
    Galectin-1 qPCR Primer Pairs, Mouse MP200130

    Galectin-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Galectin-1 cDNA ORF Clone in Cloning Vector, Human HG10290-M
    Galectin-1 cDNA ORF Clone, Human, untagged HG10290-UT
    Galectin-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10290-ACG
    Galectin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10290-ACGLN
    Galectin-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10290-ACR
    Galectin-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10290-CF
    Galectin-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10290-NF
    Galectin-1 cDNA ORF Clone, Human, C-His tag HG10290-CH
    Galectin-1 cDNA ORF Clone, Human, N-His tag HG10290-NH
    Galectin-1 cDNA ORF Clone, Human, C-HA tag HG10290-CY
    Galectin-1 cDNA ORF Clone, Human, N-HA tag HG10290-NY
    Galectin-1 cDNA ORF Clone, Human, C-Myc tag HG10290-CM
    Galectin-1 cDNA ORF Clone, Human, N-Myc tag HG10290-NM
    Galectin-1 qPCR Primer Pairs, Human HP100335
    info info
    添加购物车成功! 添加购物车失败!