IGSF8 cDNA ORF Clone, Cynomolgus, untagged

Cat: CG90732-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IGSF8 Reagents
CRO Services
Product recommended

All IGSF8 Reagents
IGSF8 cDNA ORF Clone, Cynomolgus, untagged General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1845 bp
Description
Full length Clone DNA of Cynomolgus immunoglobulin superfamily, member 8.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGSF8 Background Information
Full Name
immunoglobulin superfamily, member 8
References
  • Glazar AI, et al. (2009) Immunoglobulin superfamily member IgSF8 (EWI-2) and CD9 in fertilisation: evidence of distinct functions for CD9 and a CD9-associated protein in mammalian sperm-egg interaction. Reprod Fertil Dev. 21(2): 293-303.
  • Murdoch JN, et al. (2003) Genomic organization and embryonic expression of Igsf8, an immunoglobulin superfamily member implicated in development of the nervous system and organ epithelia. Mol Cell Neurosci. 22(1): 62-74.
  • Zhang XA, et al. (2003) EWI2/PGRL associates with the metastasis suppressor KAI1/CD82 and inhibits the migration of prostate cancer cells. Cancer Res. 63 (10): 2665-74.
  • IGSF8 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    IGSF8 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90732-G
    IGSF8 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90732-ACG
    IGSF8 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90732-ACGLN
    IGSF8 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90732-ACR
    IGSF8 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90732-CF
    IGSF8 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90732-NF
    IGSF8 cDNA ORF Clone, Cynomolgus, C-His tag CG90732-CH
    IGSF8 cDNA ORF Clone, Cynomolgus, N-His tag CG90732-NH
    IGSF8 cDNA ORF Clone, Cynomolgus, C-HA tag CG90732-CY
    IGSF8 cDNA ORF Clone, Cynomolgus, N-HA tag CG90732-NY
    IGSF8 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90732-CM
    IGSF8 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90732-NM

    IGSF8 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IGSF8 cDNA ORF Clone in Cloning Vector, Rat RG80416-G
    IGSF8 cDNA ORF Clone, Rat, untagged RG80416-UT
    IGSF8 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80416-ACGLN
    IGSF8 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80416-ACG
    IGSF8 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80416-ACR
    IGSF8 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80416-CF
    IGSF8 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80416-NF
    IGSF8 cDNA ORF Clone, Rat, C-His tag RG80416-CH
    IGSF8 cDNA ORF Clone, Rat, N-His tag RG80416-NH
    IGSF8 cDNA ORF Clone, Rat, C-HA tag RG80416-CY
    IGSF8 cDNA ORF Clone, Rat, N-HA tag RG80416-NY
    IGSF8 cDNA ORF Clone, Rat, C-Myc tag RG80416-CM
    IGSF8 cDNA ORF Clone, Rat, N-Myc tag RG80416-NM
    IGSF8 qPCR Primer Pairs, Rat RP300380

    IGSF8 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IGSF8 cDNA ORF Clone in Cloning Vector, Mouse MG51042-U
    IGSF8 cDNA ORF Clone, Mouse, untagged MG51042-UT
    IGSF8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51042-ACGLN
    IGSF8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51042-ACG
    IGSF8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51042-ACR
    IGSF8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51042-CF
    IGSF8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51042-NF
    IGSF8 cDNA ORF Clone, Mouse, C-His tag MG51042-CH
    IGSF8 cDNA ORF Clone, Mouse, N-His tag MG51042-NH
    IGSF8 cDNA ORF Clone, Mouse, C-HA tag MG51042-CY
    IGSF8 cDNA ORF Clone, Mouse, N-HA tag MG51042-NY
    IGSF8 cDNA ORF Clone, Mouse, C-Myc tag MG51042-CM
    IGSF8 cDNA ORF Clone, Mouse, N-Myc tag MG51042-NM
    IGSF8 qPCR Primer Pairs, Mouse MP201000

    IGSF8 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IGSF8 cDNA ORF Clone in Cloning Vector, Human HG13435-G
    IGSF8 cDNA ORF Clone, Human, untagged HG13435-UT
    IGSF8 cDNA ORF Clone, Human, C-GFPSpark® tag HG13435-ACG
    IGSF8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13435-ACGLN
    IGSF8 cDNA ORF Clone, Human, C-OFPSpark® tag HG13435-ACR
    IGSF8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13435-CF
    IGSF8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13435-NF
    IGSF8 cDNA ORF Clone, Human, C-His tag HG13435-CH
    IGSF8 cDNA ORF Clone, Human, N-His tag HG13435-NH
    IGSF8 cDNA ORF Clone, Human, C-HA tag HG13435-CY
    IGSF8 cDNA ORF Clone, Human, N-HA tag HG13435-NY
    IGSF8 cDNA ORF Clone, Human, C-Myc tag HG13435-CM
    IGSF8 cDNA ORF Clone, Human, N-Myc tag HG13435-NM
    IGSF8 qPCR Primer Pairs, Human HP102137
    info info
    添加购物车成功! 添加购物车失败!