GUK1 cDNA ORF Clone, Cynomolgus, C-HA tag

Cat: CG90839-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GUK1 Reagents
CRO Services
Product recommended

All GUK1 Reagents
GUK1 cDNA ORF Clone, Cynomolgus, C-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Cynomolgus guanylate kinase 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GUK1 Background Information
Full Name
guanylate kinase 1

GUK1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
GUK1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90839-G
GUK1 cDNA ORF Clone, Cynomolgus, untagged CG90839-UT
GUK1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90839-ACGLN
GUK1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90839-ACG
GUK1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90839-ANG
GUK1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90839-ACR
GUK1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90839-ANR
GUK1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90839-CF
GUK1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90839-NF
GUK1 cDNA ORF Clone, Cynomolgus, C-His tag CG90839-CH
GUK1 cDNA ORF Clone, Cynomolgus, N-His tag CG90839-NH
GUK1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90839-NY
GUK1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90839-CM
GUK1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90839-NM

GUK1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GUK1 cDNA ORF Clone in Cloning Vector, Mouse MG5A5207-U
GUK1 cDNA ORF Clone, Mouse, untagged MG5A5207-UT
GUK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5207-ACG
GUK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5207-ACGLN
GUK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5207-ANG
GUK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5207-ACR
GUK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5207-ANR
GUK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5207-CF
GUK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5207-NF
GUK1 cDNA ORF Clone, Mouse, C-His tag MG5A5207-CH
GUK1 cDNA ORF Clone, Mouse, N-His tag MG5A5207-NH
GUK1 cDNA ORF Clone, Mouse, C-HA tag MG5A5207-CY
GUK1 cDNA ORF Clone, Mouse, N-HA tag MG5A5207-NY
GUK1 cDNA ORF Clone, Mouse, C-Myc tag MG5A5207-CM
GUK1 cDNA ORF Clone, Mouse, N-Myc tag MG5A5207-NM

GUK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GUK1 cDNA ORF Clone in Cloning Vector, Human HG16439-G
GUK1 cDNA ORF Clone, Human, untagged HG16439-UT
GUK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16439-ACGLN
GUK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16439-ACG
GUK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16439-ANG
GUK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16439-ACR
GUK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16439-ANR
GUK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16439-CF
GUK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16439-NF
GUK1 cDNA ORF Clone, Human, C-His tag HG16439-CH
GUK1 cDNA ORF Clone, Human, N-His tag HG16439-NH
GUK1 cDNA ORF Clone, Human, C-HA tag HG16439-CY
GUK1 cDNA ORF Clone, Human, N-HA tag HG16439-NY
GUK1 cDNA ORF Clone, Human, C-Myc tag HG16439-CM
GUK1 cDNA ORF Clone, Human, N-Myc tag HG16439-NM
GUK1 qPCR Primer Pairs, Human HP105187
info info
添加购物车成功! 添加购物车失败!