GGPS1 cDNA ORF Clone, Cynomolgus, C-Myc tag

Cat: CG90445-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GGPS1 Reagents
CRO Services
Product recommended

All GGPS1 Reagents
GGPS1 cDNA ORF Clone, Cynomolgus, C-Myc tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
903 bp
Description
Full length Clone DNA of Cynomolgus geranylgeranyl diphosphate synthase 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GGPS1 Background Information
Full Name
geranylgeranyl diphosphate synthase 1

GGPS1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
GGPS1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90445-G
GGPS1 cDNA ORF Clone, Cynomolgus, untagged CG90445-UT
GGPS1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90445-ACG
GGPS1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90445-ACGLN
GGPS1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90445-ANG
GGPS1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90445-ACR
GGPS1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90445-ANR
GGPS1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90445-CF
GGPS1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90445-NF
GGPS1 cDNA ORF Clone, Cynomolgus, C-His tag CG90445-CH
GGPS1 cDNA ORF Clone, Cynomolgus, N-His tag CG90445-NH
GGPS1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90445-CY
GGPS1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90445-NY
GGPS1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90445-NM

GGPS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GGPS1 cDNA ORF Clone in Cloning Vector, Mouse MG5A0967-U
GGPS1 cDNA ORF Clone, Mouse, untagged MG5A0967-UT
GGPS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0967-ACG
GGPS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0967-ACGLN
GGPS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0967-ANG
GGPS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0967-ACR
GGPS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0967-ANR
GGPS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0967-CF
GGPS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0967-NF
GGPS1 cDNA ORF Clone, Mouse, C-His tag MG5A0967-CH
GGPS1 cDNA ORF Clone, Mouse, N-His tag MG5A0967-NH
GGPS1 cDNA ORF Clone, Mouse, C-HA tag MG5A0967-CY
GGPS1 cDNA ORF Clone, Mouse, N-HA tag MG5A0967-NY
GGPS1 cDNA ORF Clone, Mouse, C-Myc tag MG5A0967-CM
GGPS1 cDNA ORF Clone, Mouse, N-Myc tag MG5A0967-NM

GGPS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GGPS1 cDNA ORF Clone in Cloning Vector, Human HG15417-G
GGPS1 cDNA ORF Clone, Human, untagged HG15417-UT
GGPS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15417-ACG
GGPS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15417-ACGLN
GGPS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15417-ANG
GGPS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15417-ACR
GGPS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15417-ANR
GGPS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15417-CF
GGPS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15417-NF
GGPS1 cDNA ORF Clone, Human, C-His tag HG15417-CH
GGPS1 cDNA ORF Clone, Human, N-His tag HG15417-NH
GGPS1 cDNA ORF Clone, Human, C-HA tag HG15417-CY
GGPS1 cDNA ORF Clone, Human, N-HA tag HG15417-NY
GGPS1 cDNA ORF Clone, Human, C-Myc tag HG15417-CM
GGPS1 cDNA ORF Clone, Human, N-Myc tag HG15417-NM
GGPS1 qPCR Primer Pairs, Human HP104041
info info
添加购物车成功! 添加购物车失败!