COX8A cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90447-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All COX8A Reagents
CRO Services
Product recommended

All COX8A Reagents
COX8A cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
210 bp
Description
Full length Clone DNA of Rhesus cytochrome c oxidase subunit VIIIA (ubiquitous) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COX8A Background Information
Full Name
cytochrome c oxidase subunit VIIIA (ubiquitous)

COX8A cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
COX8A cDNA ORF Clone in Cloning Vector, Canine DG70154-U

COX8A cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
COX8A cDNA ORF Clone in Cloning Vector, Rhesus CG90447-G
COX8A cDNA ORF Clone, Rhesus, untagged CG90447-UT
COX8A Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90447-ACGLN
COX8A cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90447-ACG
COX8A cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90447-ANG
COX8A cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90447-ACR
COX8A cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90447-ANR
COX8A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90447-CF
COX8A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90447-NF
COX8A cDNA ORF Clone, Rhesus, C-His tag CG90447-CH
COX8A cDNA ORF Clone, Rhesus, N-His tag CG90447-NH
COX8A cDNA ORF Clone, Rhesus, C-HA tag CG90447-CY
COX8A cDNA ORF Clone, Rhesus, N-HA tag CG90447-NY
COX8A cDNA ORF Clone, Rhesus, N-Myc tag CG90447-NM

COX8A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COX8A cDNA ORF Clone in Cloning Vector, Mouse MG51235-U
COX8A cDNA ORF Clone, Mouse, untagged MG51235-UT
COX8A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51235-ACG
COX8A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51235-ACGLN
COX8A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51235-ANG
COX8A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51235-ACR
COX8A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51235-ANR
COX8A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51235-CF
COX8A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51235-NF
COX8A cDNA ORF Clone, Mouse, C-His tag MG51235-CH
COX8A cDNA ORF Clone, Mouse, N-His tag MG51235-NH
COX8A cDNA ORF Clone, Mouse, C-HA tag MG51235-CY
COX8A cDNA ORF Clone, Mouse, N-HA tag MG51235-NY
COX8A cDNA ORF Clone, Mouse, C-Myc tag MG51235-CM
COX8A cDNA ORF Clone, Mouse, N-Myc tag MG51235-NM
COX8A qPCR Primer Pairs, Mouse MP201118

COX8A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COX8A cDNA ORF Clone in Cloning Vector, Human HG16198-G
COX8A cDNA ORF Clone, Human, untagged HG16198-UT
COX8A cDNA ORF Clone, Human, C-GFPSpark® tag HG16198-ACG
COX8A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16198-ACGLN
COX8A cDNA ORF Clone, Human, N-GFPSpark® tag HG16198-ANG
COX8A cDNA ORF Clone, Human, C-OFPSpark® tag HG16198-ACR
COX8A cDNA ORF Clone, Human, N-OFPSpark® tag HG16198-ANR
COX8A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16198-CF
COX8A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16198-NF
COX8A cDNA ORF Clone, Human, C-His tag HG16198-CH
COX8A cDNA ORF Clone, Human, N-His tag HG16198-NH
COX8A cDNA ORF Clone, Human, C-HA tag HG16198-CY
COX8A cDNA ORF Clone, Human, N-HA tag HG16198-NY
COX8A cDNA ORF Clone, Human, C-Myc tag HG16198-CM
COX8A cDNA ORF Clone, Human, N-Myc tag HG16198-NM
COX8A qPCR Primer Pairs, Human HP104965
info info
添加购物车成功! 添加购物车失败!