BANF1 cDNA ORF Clone, Rhesus, C-His tag

Cat: CG90346-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BANF1 Reagents
CRO Services
Product recommended

All BANF1 Reagents
BANF1 cDNA ORF Clone, Rhesus, C-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
270 bp
Description
Full length Clone DNA of Rhesus barrier to autointegration factor 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BANF1 Background Information
Full Name
barrier to autointegration factor 1

BANF1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
BANF1 cDNA ORF Clone in Cloning Vector, Rhesus CG90346-G
BANF1 cDNA ORF Clone, Rhesus, untagged CG90346-UT
BANF1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90346-ACGLN
BANF1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90346-ACG
BANF1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90346-ANG
BANF1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90346-ACR
BANF1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90346-ANR
BANF1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90346-CF
BANF1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90346-NF
BANF1 cDNA ORF Clone, Rhesus, N-His tag CG90346-NH
BANF1 cDNA ORF Clone, Rhesus, C-HA tag CG90346-CY
BANF1 cDNA ORF Clone, Rhesus, N-HA tag CG90346-NY
BANF1 cDNA ORF Clone, Rhesus, C-Myc tag CG90346-CM
BANF1 cDNA ORF Clone, Rhesus, N-Myc tag CG90346-NM

BANF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BANF1 cDNA ORF Clone in Cloning Vector, Mouse MG52803-G
BANF1 cDNA ORF Clone, Mouse, untagged MG52803-UT
BANF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52803-ACG
BANF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52803-ACGLN
BANF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52803-ANG
BANF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52803-ACR
BANF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52803-ANR
BANF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52803-CF
BANF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52803-NF
BANF1 cDNA ORF Clone, Mouse, C-His tag MG52803-CH
BANF1 cDNA ORF Clone, Mouse, N-His tag MG52803-NH
BANF1 cDNA ORF Clone, Mouse, C-HA tag MG52803-CY
BANF1 cDNA ORF Clone, Mouse, N-HA tag MG52803-NY
BANF1 cDNA ORF Clone, Mouse, C-Myc tag MG52803-CM
BANF1 cDNA ORF Clone, Mouse, N-Myc tag MG52803-NM

BANF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BANF1 cDNA ORF Clone in Cloning Vector, Human HG16240-G
BANF1 cDNA ORF Clone, Human, untagged HG16240-UT
BANF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16240-ACG
BANF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16240-ACGLN
BANF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16240-ANG
BANF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16240-ACR
BANF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16240-ANR
BANF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16240-CF
BANF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16240-NF
BANF1 cDNA ORF Clone, Human, C-His tag HG16240-CH
BANF1 cDNA ORF Clone, Human, N-His tag HG16240-NH
BANF1 cDNA ORF Clone, Human, C-HA tag HG16240-CY
BANF1 cDNA ORF Clone, Human, N-HA tag HG16240-NY
BANF1 cDNA ORF Clone, Human, C-Myc tag HG16240-CM
BANF1 cDNA ORF Clone, Human, N-Myc tag HG16240-NM
BANF1 qPCR Primer Pairs, Human HP105004
info info
添加购物车成功! 添加购物车失败!