ATP5SL cDNA ORF Clone, Rhesus, C-His tag

Cat: CG90369-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATP5SL Reagents
CRO Services
Product recommended

All ATP5SL Reagents
ATP5SL cDNA ORF Clone, Rhesus, C-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
771 bp
Description
Full length Clone DNA of Rhesus ATP5S-like with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP5SL Background Information
Full Name
ATP5S-like

ATP5SL cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ATP5SL cDNA ORF Clone in Cloning Vector, Rhesus CG90369-G
ATP5SL cDNA ORF Clone, Rhesus, untagged CG90369-UT
ATP5SL Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90369-ACGLN
ATP5SL cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90369-ACG
ATP5SL cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90369-ANG
ATP5SL cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90369-ACR
ATP5SL cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90369-ANR
ATP5SL cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90369-CF
ATP5SL cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90369-NF
ATP5SL cDNA ORF Clone, Rhesus, N-His tag CG90369-NH
ATP5SL cDNA ORF Clone, Rhesus, C-HA tag CG90369-CY
ATP5SL cDNA ORF Clone, Rhesus, N-HA tag CG90369-NY
ATP5SL cDNA ORF Clone, Rhesus, C-Myc tag CG90369-CM
ATP5SL cDNA ORF Clone, Rhesus, N-Myc tag CG90369-NM

ATP5SL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP5SL cDNA ORF Clone in Cloning Vector, Rat RG81464-G

ATP5SL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP5SL cDNA ORF Clone in Cloning Vector, Mouse MG52678-G
ATP5SL cDNA ORF Clone, Mouse, untagged MG52678-UT
ATP5SL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52678-ACGLN
ATP5SL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52678-ACG
ATP5SL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52678-ANG
ATP5SL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52678-ACR
ATP5SL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52678-ANR
ATP5SL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52678-CF
ATP5SL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52678-NF
ATP5SL cDNA ORF Clone, Mouse, C-His tag MG52678-CH
ATP5SL cDNA ORF Clone, Mouse, N-His tag MG52678-NH
ATP5SL cDNA ORF Clone, Mouse, C-HA tag MG52678-CY
ATP5SL cDNA ORF Clone, Mouse, N-HA tag MG52678-NY
ATP5SL cDNA ORF Clone, Mouse, C-Myc tag MG52678-CM
ATP5SL cDNA ORF Clone, Mouse, N-Myc tag MG52678-NM
ATP5SL qPCR Primer Pairs, Mouse MP202549

ATP5SL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP5SL cDNA ORF Clone, Human, untagged HG19934-UT
info info
添加购物车成功! 添加购物车失败!