ALK-1 cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90060-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ALK-1 Reagents
CRO Services
Product recommended

All ALK-1 Reagents
ALK-1 cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1512 bp
Description
Full length Clone DNA of Rhesus activin A receptor type II-like 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALK-1 Background Information

Activin A receptor, type II-like 1 (ACVRL1), also known as ALK-1 (activin receptor-like kinase 1), is an endothelial-specific type I receptor of the TGF-beta (transforming growth factor beta) receptor family of ligands. On ligand binding, a heteromeric receptor complex forms consisting of two type II and two type I transmembrane serine/threonine kinases. ACVRL1 protein is expressed in certain blood vessels of kidney, spleen, heart and intestine, serving as an important role during vascular development. Mutations in ACVRL1 gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2 and vascular disease.

Full Name
activin A receptor type II-like 1
References
  • French Rendu-Osler network,et al. (2004) Molecular screening of ALK1/ACVRL1 and ENG genes in hereditary hemorrhagic telangiectasia in France. Hum Mutat. 23(4): 289-299.
  • Simon M, et al. (2006) Association of a polymorphism of the ACVRL1 gene with sporadic arteriovenous malformations of the central nervous system. J Neurosurg. 104(6): 945-9.
  • Argyriou L, et al. (2006) Novel mutations in the ENG and ACVRL1 genes causing hereditary hemorrhagic teleangiectasia. Int J Mol Med. 17(4):655-9.
  • ALK-1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    ALK-1 cDNA ORF Clone in Cloning Vector, Canine DG70049-G
    ALK-1 cDNA ORF Clone, Canine, untagged DG70049-UT
    ALK-1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70049-ACG
    ALK-1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70049-ACGLN
    ALK-1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70049-ACR
    ALK-1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70049-CF
    ALK-1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70049-NF
    ALK-1 cDNA ORF Clone, Canine, C-His tag DG70049-CH
    ALK-1 cDNA ORF Clone, Canine, N-His tag DG70049-NH
    ALK-1 cDNA ORF Clone, Canine, C-HA tag DG70049-CY
    ALK-1 cDNA ORF Clone, Canine, N-HA tag DG70049-NY
    ALK-1 cDNA ORF Clone, Canine, C-Myc tag DG70049-CM
    ALK-1 cDNA ORF Clone, Canine, N-Myc tag DG70049-NM

    ALK-1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    ALK-1 cDNA ORF Clone in Cloning Vector, Rhesus CG90060-G
    ALK-1 cDNA ORF Clone, Rhesus, untagged CG90060-UT
    ALK-1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90060-ACG
    ALK-1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90060-ACGLN
    ALK-1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90060-ACR
    ALK-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90060-CF
    ALK-1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90060-NF
    ALK-1 cDNA ORF Clone, Rhesus, C-His tag CG90060-CH
    ALK-1 cDNA ORF Clone, Rhesus, N-His tag CG90060-NH
    ALK-1 cDNA ORF Clone, Rhesus, C-HA tag CG90060-CY
    ALK-1 cDNA ORF Clone, Rhesus, N-HA tag CG90060-NY
    ALK-1 cDNA ORF Clone, Rhesus, N-Myc tag CG90060-NM

    ALK-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ALK-1 cDNA ORF Clone in Cloning Vector, Rat RG80132-G
    ALK-1 cDNA ORF Clone, Rat, untagged RG80132-UT
    ALK-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80132-ACG
    ALK-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80132-ACGLN
    ALK-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80132-ACR
    ALK-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80132-CF
    ALK-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80132-NF
    ALK-1 cDNA ORF Clone, Rat, C-His tag RG80132-CH
    ALK-1 cDNA ORF Clone, Rat, N-His tag RG80132-NH
    ALK-1 cDNA ORF Clone, Rat, C-HA tag RG80132-CY
    ALK-1 cDNA ORF Clone, Rat, N-HA tag RG80132-NY
    ALK-1 cDNA ORF Clone, Rat, C-Myc tag RG80132-CM
    ALK-1 cDNA ORF Clone, Rat, N-Myc tag RG80132-NM
    ALK-1 qPCR Primer Pairs, Rat RP300129

    ALK-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ALK-1 cDNA ORF Clone in Cloning Vector, Mouse MG50208-M
    ALK-1 cDNA ORF Clone, Mouse, untagged MG50208-UT
    ALK-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50208-ACGLN
    ALK-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50208-ACG
    ALK-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50208-ACR
    ALK-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50208-CF
    ALK-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50208-NF
    ALK-1 cDNA ORF Clone, Mouse, C-His tag MG50208-CH
    ALK-1 cDNA ORF Clone, Mouse, N-His tag MG50208-NH
    ALK-1 cDNA ORF Clone, Mouse, C-HA tag MG50208-CY
    ALK-1 cDNA ORF Clone, Mouse, N-HA tag MG50208-NY
    ALK-1 cDNA ORF Clone, Mouse, C-Myc tag MG50208-CM
    ALK-1 cDNA ORF Clone, Mouse, N-Myc tag MG50208-NM
    ALK-1 qPCR Primer Pairs, Mouse MP200236

    ALK-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ALK-1 cDNA ORF Clone in Cloning Vector, Human HG10066-M
    ALK-1 cDNA ORF Clone, Human, untagged HG10066-UT
    ALK-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10066-ACG
    ALK-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10066-ACGLN
    ALK-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10066-ACR
    ALK-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10066-CF
    ALK-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10066-NF
    ALK-1 cDNA ORF Clone, Human, C-His tag HG10066-CH
    ALK-1 cDNA ORF Clone, Human, N-His tag HG10066-NH
    ALK-1 cDNA ORF Clone, Human, C-HA tag HG10066-CY
    ALK-1 cDNA ORF Clone, Human, N-HA tag HG10066-NY
    ALK-1 cDNA ORF Clone, Human, C-Myc tag HG10066-CM
    ALK-1 cDNA ORF Clone, Human, N-Myc tag HG10066-NM
    ALK-1 qPCR Primer Pairs, Human HP100152
    info info
    添加购物车成功! 添加购物车失败!