SNX3 cDNA ORF Clone, Canine, C-His tag

Cat: DG70201-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SNX3 Reagents
CRO Services
Product recommended

All SNX3 Reagents
SNX3 cDNA ORF Clone, Canine, C-His tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
489 bp
Description
Full length Clone DNA of Canine sorting nexin 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNX3 Background Information
Full Name
sorting nexin 3

SNX3 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
SNX3 cDNA ORF Clone in Cloning Vector, Canine DG70201-U
SNX3 cDNA ORF Clone, Canine, untagged DG70201-UT
SNX3 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70201-ACGLN
SNX3 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70201-ACG
SNX3 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70201-ANG
SNX3 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70201-ACR
SNX3 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70201-ANR
SNX3 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70201-CF
SNX3 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70201-NF
SNX3 cDNA ORF Clone, Canine, N-His tag DG70201-NH
SNX3 cDNA ORF Clone, Canine, C-HA tag DG70201-CY
SNX3 cDNA ORF Clone, Canine, N-HA tag DG70201-NY
SNX3 cDNA ORF Clone, Canine, C-Myc tag DG70201-CM
SNX3 cDNA ORF Clone, Canine, N-Myc tag DG70201-NM

SNX3 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
SNX3 cDNA ORF Clone in Cloning Vector, Ferret FG60139-G
SNX3 cDNA ORF Clone, Ferret, untagged FG60139-UT
SNX3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60139-ACGLN
SNX3 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60139-ACG
SNX3 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60139-ANG
SNX3 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60139-ACR
SNX3 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60139-ANR
SNX3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60139-CF
SNX3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60139-NF
SNX3 cDNA ORF Clone, Ferret, C-His tag FG60139-CH
SNX3 cDNA ORF Clone, Ferret, N-His tag FG60139-NH
SNX3 cDNA ORF Clone, Ferret, C-HA tag FG60139-CY
SNX3 cDNA ORF Clone, Ferret, N-HA tag FG60139-NY
SNX3 cDNA ORF Clone, Ferret, C-Myc tag FG60139-CM
SNX3 cDNA ORF Clone, Ferret, N-Myc tag FG60139-NM

SNX3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SNX3 cDNA ORF Clone in Cloning Vector, Mouse MG52080-G
SNX3 cDNA ORF Clone, Mouse, untagged MG52080-UT
SNX3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52080-ACGLN
SNX3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52080-ACG
SNX3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52080-ANG
SNX3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52080-ACR
SNX3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52080-ANR
SNX3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52080-CF
SNX3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52080-NF
SNX3 cDNA ORF Clone, Mouse, C-His tag MG52080-CH
SNX3 cDNA ORF Clone, Mouse, N-His tag MG52080-NH
SNX3 cDNA ORF Clone, Mouse, C-HA tag MG52080-CY
SNX3 cDNA ORF Clone, Mouse, N-HA tag MG52080-NY
SNX3 cDNA ORF Clone, Mouse, C-Myc tag MG52080-CM
SNX3 cDNA ORF Clone, Mouse, N-Myc tag MG52080-NM
SNX3 qPCR Primer Pairs, Mouse MP201953

SNX3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SNX3 cDNA ORF Clone in Cloning Vector, Human HG14541-G
SNX3 cDNA ORF Clone, Human, untagged HG14541-UT
SNX3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14541-ACG
SNX3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14541-ACGLN
SNX3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14541-ANG
SNX3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14541-ACR
SNX3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14541-ANR
SNX3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14541-CF
SNX3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14541-NF
SNX3 cDNA ORF Clone, Human, C-His tag HG14541-CH
SNX3 cDNA ORF Clone, Human, N-His tag HG14541-NH
SNX3 cDNA ORF Clone, Human, C-HA tag HG14541-CY
SNX3 cDNA ORF Clone, Human, N-HA tag HG14541-NY
SNX3 cDNA ORF Clone, Human, C-Myc tag HG14541-CM
SNX3 cDNA ORF Clone, Human, N-Myc tag HG14541-NM
SNX3 qPCR Primer Pairs, Human HP103188
info info
添加购物车成功! 添加购物车失败!